A real-time fluorescent quantitative PCR primer, kit and method for detecting lentivirus virus titer

A real-time fluorescence quantitative and virus titer technology, which is applied in the field of kits and real-time fluorescent quantitative PCR primers, can solve the problems of not reflecting the real infection activity of the virus, not being able to accurately measure the virus titer, and inaccurate virus titer detection results, etc. Achieve the effect of real infectious vitality

Active Publication Date: 2022-07-22
YUNZHOU BIOSCIENCES (GUANGZHOU) INC
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, both the free P24 protein and the P24 protein on the inactive virus particles can react with the antibody to affect the results, so the titer of the virus cannot be accurately determined
[0007] In the RT-qPCR method, the efficiency of RNA will affect the final result, and the RT-qPCR method will also count the nucleic acid of virus particles that contain nucleic acid but lose their infectious activity, which cannot reflect the real infection activity of the virus. The titer detection of the virus The results are inaccurate, thus limiting the application of the method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A real-time fluorescent quantitative PCR primer, kit and method for detecting lentivirus virus titer
  • A real-time fluorescent quantitative PCR primer, kit and method for detecting lentivirus virus titer
  • A real-time fluorescent quantitative PCR primer, kit and method for detecting lentivirus virus titer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Design of specific primers

[0040] According to the published viral sequences, the present invention selects the envelope region of the lentivirus to design primers; the designed primers are preliminarily screened to obtain a set of primer pairs with high versatility, good sensitivity and specificity, Its nucleotide sequence is as follows:

[0041] ENV-F:CGCAGTTAATCCTGGCCTGTTA(SEQ.ID:NO.1);

[0042] ENV-R: ATCCTTTGATGCACACAATAGAGG (SEQ. ID: NO. 2).

[0043] Using the lentiviral shuttle plasmid as a template, the amplified sequence is:

[0044] cgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattataataatacagtagcaaccctctattgtgtgtgcatcaaaggat(SEQ.ID:NO.3);

[0045] The length of the amplified fragment was 144 bp.

[0046] Internal reference BMP2 (Homo sapiens bone morphogenetic protein 2, bone morphogenetic protein 2) primers:

[0047] BMP2-F: TAGGGTAGACAGAGCCAAGG (SEQ. ID: NO.4);

[0048] BMP2-R: AGCACAGGA...

Embodiment 2

[0052] Example 2 Preparation of standard substance and real-time quantitative PCR (qPCR) detection

[0053] 1. Preparation of standards

[0054] Using the ENV-F, ENV-R, BMP2-F, BMP2-R primers of Example 1, the target fragment was amplified, and the amplified product was connected to pMD TM 18-T vector. The constructed vector was double digested by AhdI and NdeI, and the digested product was recovered and its concentration and purity were determined by NanoDrop. For the samples that meet the purity, the number of molecules is calculated according to the molecular weight of the fragments and Avogadro's constant, which are used as the standard for virus quantification, which are the ENV standard and the internal reference BMP2 standard.

[0055] The specific calculation formula is: sample copy number per 1uL fragment = A × N × 10 -9 / M. where A is the DNA concentration measured in ng / uL; N is Avogadro’s constant (6.02×10 23 / mol); M is the molecular weight of the fragment.

...

Embodiment 3

[0068] Example 3 Real-time fluorescent quantitative PCR of genomic DNA of target cells

[0069] (1) Virus-transduced 293T cells:

[0070] Take 3 x 10 per hole 5 293T cells were inoculated into 6-well plates, and the cells in one well were taken for trypsin digestion and counted before virus transduction the next day, and the counted results were saved and recorded as B. Use 293T complete medium to dilute the virus product by 100 times, add 50uL of the diluted virus solution to one well of a 6-well plate, and add 10uL, 0.5mg / mL polybrene to promote transduction, keep one Cells without any virus transduction in the well were used as a negative control and were placed in a 37°C incubator for further culture.

[0071] (2) Extraction of cellular genomic DNA:

[0072] 48 hours after viral transduction, cells were collected, and target cell genomic DNA was extracted with a blood tissue cell genome extraction kit (Tiangen, DP304).

[0073] (3) quantitative PCR analysis:

[0074] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a real-time fluorescent quantitative PCR primer, a kit and a method for detecting the titer of lentivirus. The primer of the invention falls on the envelope of the lentivirus, and the titer can be detected without a fluorescent label. In addition, the present invention detects the virus infected with cells and successfully integrated, which can reflect the true infection activity of the virus, and is not affected by the extraction efficiency of cell genome DNA, and has the characteristics of simple operation and high sensitivity.

Description

technical field [0001] The invention relates to the technical field of lentivirus virus titer detection, in particular to a real-time fluorescent quantitative PCR primer, a kit and a method for detecting the lentivirus virus titer. Background technique [0002] Lentiviral vector (LVs) is a viral vector system transformed on the basis of HIV-1 (human immunodeficiency virus type I) virus. Infectious ability, can efficiently introduce the target gene (or RNAi) into animal and human primary cells or cell lines. The genome of lentivirus is two identical positive-strand RNAs. After infecting cells, it is reverse transcribed into DNA by its own reverse transcriptase in the cytoplasm to form a pre-DNA integration complex. After entering the nucleus, the DNA is integrated into the cell genome. middle. The integrated DNA transcribes mRNA, returns to the cytoplasm, expresses the target protein, or produces RNAi interference. [0003] The expression vector and the auxiliary packaging...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/702C12Q2600/166C12Q2531/113C12Q2545/101C12Q2563/107
Inventor蓝田施金秀陈银娜
OwnerYUNZHOU BIOSCIENCES (GUANGZHOU) INC