Alkaline protease gene and construction method of recombinant bacillus subtilis strain thereof

A technology of Bacillus subtilis and protease, applied in the field of genetic engineering, can solve the problems of low expression activity and the like

Active Publication Date: 2018-09-25
横琴仲泰生物医药有限公司
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the impact of the gene in the alkaline protease and the influence of the adaptability of the gene sequence, the expression activity of the engineering strain is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alkaline protease gene and construction method of recombinant bacillus subtilis strain thereof
  • Alkaline protease gene and construction method of recombinant bacillus subtilis strain thereof
  • Alkaline protease gene and construction method of recombinant bacillus subtilis strain thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Alkaline protease gene Bmp codon optimization

[0029] For the Bacillus subtilis expression system, use the online software Graphical Codon Usage Analyzer (http: / / gcua.schoedl.de / ) to analyze the codons of the alkaline protease gene Bmp without signal peptide, find out low-frequency codons, and carry out optimization. The optimized gene Bmp-opt was synthesized by Gene Synthesis Company. After optimization, the codon adaptation index of gene Bmp was increased from 0.48 to 0.95, and the GC content was adjusted from 49.6% to 45.1%. The bases A, T, C and G are evenly distributed in the optimized gene Bmp-opt, which reduces the AT and GC-rich regions, which is beneficial to the expression of Bmp in Bacillus subtilis. The similarity between the optimized gene Bmp-opt and the original gene was 76%.

Embodiment 2

[0030] Example 2 Construction of bacillus subtilis 168 alkaline protease deletion strain

[0031]Bacillus subtilis 168 was inserted into LB medium, and after culturing at 37°C for 24 hours, genomic DNA was extracted. The upstream homology arm of alkaline protease was amplified with primer apre1-fw (ATCGGGATCCAGAGCGATTGCGGCTGTGTAC) and primer apre1-rev (AACGTGAGTTCCGTGAGAGTTGTTGTCTTGGAAAGGAT) and apre2-fw (ATCCTTTCCAAGACAACAACTC TCACGGAACTCACGTT) with primer apre2-rev (alkaline ATCGTCTAAGAGGAATGCTTCAase) downstream homology arm. The amplified upstream and downstream homology arms are fused with the overlap PCR method, and the overlap PCR reaction system and conditions are as follows:

[0032]

[0033] Overlap PCR reaction conditions were: 98°C, pre-denaturation for 20s; 98°C, pre-denaturation for 10s; 58°C, annealing for 30s; 72°C, extension for 1min; 30 cycles, and finally 72°C, extension for 5min. Use the fused PCR product as a template to amplify with primers apre1-fw a...

Embodiment 3

[0036] The construction of embodiment 3 Bacillus subtilis neutral protease deletion strain

[0037] The construction method of the neutral protease-deficient strain is the same as in Example 2. Using the Bacillus subtilis 168 genome as a template, use primer npre1-fw (ATCGGGATCCGCTGAAGGTCATCAGCTTAAA) and primer npre1-rev (AGGTTTAGAAAGATCACGCATTTTACTGCCTTTGTTATC) to amplify the upstream homology arm of neutral protease, use primer npre2-fw (GATAACAAAGGCAGTAAAATGCGTGATCTTTCTAAACCT) and primer (apre2-rev ATCGTCTAGATTACAAGCCGACCGCATTCCA) amplifies the downstream homology arms of dispase. The amplified upstream and downstream homology arms are fused with the overlapping PCR method, and the overlapping PCR reaction system and conditions are as follows:

[0038]

[0039] Overlap PCR reaction conditions were: 98°C, pre-denaturation for 20s; 98°C, pre-denaturation for 10s; 58°C, annealing for 30s; 72°C, extension for 1min; 30 cycles, and finally 72°C, extension for 5min. Use the f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an alkaline protease gene and a construction method of recombinant bacillus subtilis strain thereof, belonging to the field of genetic engineering. According to the invention,the gene sequence of the alkaline protease BmP is optimized according to bacillus subtilis codon preference to obtain Bmp-opt, and at the same time, the alkaline protease, neutral protease and mediumtemperature amylase of bacillus subtilis 168 are knocked out through a gene knockout technique to obtain a mutant strain Bs1. The optimized alkaline protease gene Bmp-opt is expressed in the mutant strain Bs1, and finally the recombinant bacillus subtilis strain efficiently expressing the alkaline protease BmP is obtained.

Description

technical field [0001] The invention relates to a construction method of an alkaline protease gene and a recombinant Bacillus subtilis strain, belonging to the field of genetic engineering. Background technique [0002] Proteases are a class of enzymes that catalyze the hydrolysis of proteins. According to the source of protease, it can be divided into animal protease, plant protease and microbial protease. Compared with animal proteases and plant proteases, proteases derived from microorganisms have a wider range of action and more types of hydrolyzed substrates. Proteases derived from microorganisms can be divided into acidic, neutral and alkaline proteases according to their optimal reaction pH environment. Alkaline protease is a class of enzymes that hydrolyze proteins under alkaline conditions. Alkaline protease is widely used in food, washing, feed and other industrial fields because of its strong hydrolysis ability. [0003] At present, there are mainly two ways to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/57C12N1/21C12N15/75C12N15/90C12N15/56C12N9/54C12R1/125
CPCC12N9/2411C12N9/54C12N15/75C12N15/902C12N2800/22
Inventor刘丹妮
Owner横琴仲泰生物医药有限公司