IOT (internet of things) anti-counterfeiting traceability system for rapid identification of donkey-hide gelatin DNA (deoxyribonucleic acid) and anti-counterfeiting traceability method
A technology of the Internet of Things and DNA chips, applied in biochemical equipment and methods, transmission systems, bioreactors/fermenters for specific purposes, etc., to achieve the effects of copy control and good anti-counterfeiting means
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Prepare the DNA chip, the specific process is as follows:
[0048] 1. Attach a layer of 150nm metal film on the surface of the silicon chip through the metal coating process, which can be Au or Ag;
[0049] 2. Thiolate the probe gene fragment, and then point different thiolated probes to different regions, and keep it at 4°C for 12 hours, including according to donkey, pig, cow, sheep, horse,
[0050] Rabbit gene designed probes:
[0051] donkey,AACGTAGGTCTGACGTGACTCCCCGA;
[0052] Pig, CCTATATACCGCCATCTTC;
[0053] Cow, GAGGAGCCTGTTCCGTAATCGAT;
[0054] Sheep, TCAAGCACACTACAAAGTATCGC;
[0055] horse, GTAAATTAAGAAAGAGAGCTTAATT;
[0056] Rabbit, ACACCTTGCTAGGCCACACCCACGGG.
[0057] 3. Then wash off unbound probes on the surface of the metal film with deionized water, and then blow dry with nitrogen.
[0058] The DNA chip prepared by the above method has good stability and can be circulated in the market for a long time. The DNA probes on the surface are designed f...
Embodiment 2
[0060] Construct the donkey-hide gelatin DNA database, the specific process is as follows:
[0061] 1. Extract genuine donkey-hide gelatin samples through the silica bead method, the specific process is as follows:
[0062] (a) Add 4ml of CTAB extract and 80ul of mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take a sample of donkey-hide gelatin, crush it into powder, transfer it to the preheated centrifuge tube, seal it, and heat it at 65°C. Incubate in a water bath at ±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, add 4ml of chloroform-isoamyl alcohol mixed solution, mix well, and form a mixed emulsion;
[0063] (b) Add 100ul of silica bead suspension to the mixed emulsion, mix well, let stand for 10 minutes, centrifuge at 8000rpm15s at 4 degrees, remove the supernatant, and wash the precipitate twice with 1ml washing liquid and twice with 1ml ice ethanol, Dry at 60°C for 5 minutes;
[0064] (c) A...
Embodiment 3
[0071] To check the validity of the DNA chip and Ejiao DNA database, the inspectors do not know the authenticity of the tested Ejiao samples:
[0072] 1. The tested donkey-hide gelatin sample was extracted by the silica bead method, and the specific process was as follows:
[0073] (a) Add 4ml of CTAB extract and 80ul of mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take a sample of donkey-hide gelatin, crush it into powder, transfer it to the preheated centrifuge tube, seal it, and heat it at 65°C. Incubate in a water bath at ±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, add 4ml of chloroform-isoamyl alcohol (24:1) mixed solution, mix well, and form a mixed emulsion;
[0074] (b) Add 100ul silica bead suspension to the mixed emulsion, mix well, let it stand for 10 minutes, centrifuge at 8000rpm 15s at 4 degrees, remove the supernatant, and wash the precipitate twice with 1ml washing liquid and twic...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

