Rapid identification Internet-of-Things anti-counterfeiting tracing system and anti-counterfeiting tracing method
An Internet of Things and fast technology, which is applied in the field of ginseng identification and anti-counterfeiting, can solve the problems of harm and side effects, and achieve the effect of controlling copying and good anti-counterfeiting means
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Prepare the DNA chip, the specific process is as follows:
[0044] 1. Attach a layer of 150nm metal film on the surface of the silicon chip through the metal coating process, which can be Au or Ag;
[0045] 2. Thiolate the gene fragment of the probe, and then point different thiolated probes to different regions, and keep it at 4°C for 12 hours, wherein the gene probes include the following probes:
[0046] Probe one: GTTCAGTGATATGCTTAACGG;
[0047] Probe two: TGAGGTTCCTACCTGATTCAG;
[0048] Probe three: ATGAATTTTGAAGCCC;
[0049] Probe four: TATAGATAATC;
[0050] Probe five: ATTATAGATACACAC;
[0051] Probe six: GATTCGAGCGTTCAAATGAT;
[0052] 3. Then wash off unbound probes on the surface of the metal film with deionized water, and then blow dry with nitrogen.
[0053] The DNA chip prepared by the above method has good stability and can be circulated in the market for a long time. The DNA probe on the surface is designed for the DNA sequence of ginseng, and some e...
Embodiment 2
[0055] To construct the ginseng DNA database, the specific process is as follows:
[0056] 1. The ginseng sample is extracted by CTAB method, the specific process is as follows: Add 4ml CTAB extract and 80ul mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take the ginseng sample, grind it into powder with liquid nitrogen, and transfer it to the preheated tube. In the heated centrifuge tube, seal it, keep it warm in a water bath at 65±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, add 4ml of phenol:chloroform:isoamyl alcohol and mix in a ratio of 25:24:1 solution, mix well to form a mixed emulsion; centrifuge at 12000r / min for 10min, take the supernatant, add 4ml of chloroform: isoamyl alcohol as a 24:1 mixed solution, mix well and place it at room temperature for 10-20min, 12000r / min Centrifuge for 10 min, remove the supernatant, wash the precipitate with absolute ethanol and 70% ethanol in turn, add TE...
Embodiment 3
[0062] To check the validity of the DNA chip and the ginseng DNA database, the inspectors do not know the authenticity of the tested ginseng samples:
[0063] 1. Extract the tested ginseng sample by CTAB method, the specific process is as follows: add 4ml CTAB extract and 80ul mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take the ginseng sample, grind it into powder with liquid nitrogen , transferred to a preheated centrifuge tube, sealed, and incubated in a water bath at 65±5°C for 30±10 minutes, took out the centrifuge tube, cooled down to room temperature quickly, and added 4ml of phenol: chloroform: isoamyl alcohol to a ratio of 25: 24:1 mixed solution, mix well to form a mixed emulsion; centrifuge at 12000r / min for 10min, take the supernatant, add 4ml of chloroform: isoamyl alcohol to the mixed solution of 24:1, mix well and place it at room temperature for 10- Centrifuge at 12000r / min for 10min for 20min, remove the supernatant, wash the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

