Method for improving cellulose utilization ratio by using glycosyl transferase promoter to drive GA20ox

A glycosyltransferase and promoter technology, applied in the field of genetic engineering, to achieve the effects of increased S/G ratio, more biomass, great research value and application potential

Pending Publication Date: 2018-11-13
INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no studies on how GA2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving cellulose utilization ratio by using glycosyl transferase promoter to drive GA20ox
  • Method for improving cellulose utilization ratio by using glycosyl transferase promoter to drive GA20ox
  • Method for improving cellulose utilization ratio by using glycosyl transferase promoter to drive GA20ox

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0063] Example 1

[0064] To further illustrate the method of the present invention for using the glycosyltransferase 8D1 promoter to drive GA20ox to improve the utilization of lignocellulose, the specific method and data for preparing 8D1P:GA20ox transgenic 84K poplar through genetic engineering will be described as follows:

[0065] The drugs involved in the experiment in Example 1 were all purchased from Sigma, Fermentas, ThermoFisher, and Shanghai Shenggong Company.

[0066] Molecular cloning of GA20ox gene

[0067] 1. Extract Arabidopsis stems to extract its total RNA, amplify the full-length cDNA of GA20ox gene using RT-PCR technology, and sequence it. See SEQ ID No. 1 for the sequence. The amplification conditions were: 95°C for 5min pre-denaturation; 94°C for 30s, 55°C for 40s, 72°C for 1min, 35 cycles completed; 72°C for 8min fragment extension. The amplification primers are:

[0068] ArGA2OF: TGCAGGATCCATGGCCGTAAGTTTCGTAAC

[0069] ArGA2OR: TGCAGAGCTC TTAGATGGGTTTGGTGAGCC2.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for improving a cellulose utilization ratio by using a glycosyl transferase 8D1 promoter to drive a GA20ox. The method comprises the following steps: using the glycosyl transferase 8D1 promoter of the xylem specific expression to drive the gibberellin oxidase GA20ox gene to excessively express and change structural compositions of aspen xylogen; through acquiringa recombinant vector excessively expressed by the GA20ox gene driven by the promoter 8D1P specifically expressed in the aspen stalk xylem, enabling the recombinant vector to be used for genetic transformation of an aspen, to obtain the 8D1P:GA20ox transgene aspen, and achieving a purpose of improving wood properties. The improvement of the wood properties of the transgene aspen is that a biomass of the aspen is increased, an S/G specific value in the xylogen is improved, so the cellulose hydrolysis efficiency can be improved, and a lignocellulose utilization ratio of pulping and papermaking isimproved.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for improving the utilization rate of lignocellulose by using the glycosyltransferase 8D1 promoter to drive the overexpression of the gibberellin synthesis gene GA20ox. Background technique [0002] Lignocellulose is the largest amount of renewable resources on the earth. The anti-degradation barrier effect produced by the tight combination of lignin, hemicellulose and cellulose is the main obstacle to the utilization of cellulose as energy, and the lignin in the cell wall is a major factor in the pulp and paper industry and the high cost of producing bioethanol. Lignin is composed of three structural units: p-hydroxyphenyl (H), guaiacyl (G) and syringyl (S). If the physiological growth and development of trees are regulated by genetic engineering, and the lignin content and component structure in the plant are changed (increasing the S / G ratio), it will have an impor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82A01H5/00
CPCC12N9/0006C12N15/8255C12N15/8261
Inventor 彭霄鹏
Owner INST OF FORESTRY CHINESE ACAD OF FORESTRY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap