A kind of bn-mir12 of ramie and its application
A technology of bn-mir12 and ramie, applied in the field of botany, can solve problems not related to the molecular mechanism of ramie absorbing cadmium, achieve potential application value, and promote the effect of absorption
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Screening and identification of embodiment 1miRNA
[0021] 1. Plant Material and Sample Preparation
[0022] Treatment group: Take the young shoots (10-15cm) of Ramie Zhongzhu No. 1 variety, sterilize them with carbendazim for 10s, cut them in a water circulation device, and place them in an artificial climate greenhouse for cultivation. When the roots grow to 10cm, use 10mg / L concentration of For cadmium chloride treatment, fully expanded ramie leaves were collected after 20 days of treatment, and after liquid nitrogen quick freezing, they were frozen at -80°C for later use.
[0023] Control group: the cadmium chloride of 10 mg / L concentration in the treatment group was replaced with water, and the rest of the experimental conditions were unchanged, as a control group.
[0024] 2. High-throughput sequencing of ramie miRNA
[0025] RNA extraction: After the leaves were ground into powder in liquid nitrogen, RNA was extracted using the EASYspin plant microRNA rapid ext...
Embodiment 2
[0033] Example 2 Analysis of the expression level of Bn-miR12
[0034] 1. The preparation of plant materials and samples is the same as in Example 1.
[0035] 2. Bn-miR12 expression analysis
[0036] The extracted qualified RNA was used as the sample, and it was reverse-transcribed into the first strand of cDNA using the Specific Stem-loop RT Primer third-generation kit. The cDNA was used as the template, and the general reverse primer and forward primer F1 in the kit were used for reverse transcription. The expression of Bn-miR12 was detected by q-PCR, and the primer pair composed of F2 and R2 was used to detect 18SrRNA (internal reference gene) by q-PCR, and the relative expression of Bn-miR12 was calculated.
[0037] The specific operation steps are as follows:
[0038]1) RNA extraction: Take the sample stored at -80°C, grind it into powder with liquid nitrogen, take about 100 mg of the powder, quickly add 1 ml of refrigerated trizol, and homogenize for 2 minutes with a h...
Embodiment 3
[0064] Example 3 Analysis of the expression level of the target gene comp44118_c0 of Bn-miR12
[0065] 1. The preparation of plant materials and samples is the same as in Example 1.
[0066] 2. Expression analysis of Bn-miR12 target genes
[0067] Prepare the cDNA sample according to the method of 18SrRNA reverse transcription in Example 2, use the target gene forward primer F3: CTCGCAACTTTTCCAAAAACC (sequence 8) and reverse primer F3: TTGCTCTGTTTTTGGGCTCT (sequence 9) primer pair to amplify the target gene, using 18SrRNA as an internal reference Gene (forward primer F4: TGACGGAGAATTAGGGTTCGA (sequence 10); reverse primer F4: CCGTGTCAGGATTGGGTAATTT (sequence 11)), the expression of the target gene was detected on a Roche light cycler 480II PCR instrument, and the PCR reaction system and reaction procedure were the same as in Example 2 Medium 18SrRNA. The expression of the target gene as Figure 4 shown. The results showed that under cadmium stress, the expression level of ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


