Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of bn-mir12 of ramie and its application

A technology of bn-mir12 and ramie, applied in the field of botany, can solve problems not related to the molecular mechanism of ramie absorbing cadmium, achieve potential application value, and promote the effect of absorption

Active Publication Date: 2021-06-08
INST OF BAST FIBER CROPS CHINESE ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current methods of improving the absorption of cadmium by ramie are all auxiliary improvements, and have not involved the study of the molecular mechanism of ramie absorption of cadmium.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of bn-mir12 of ramie and its application
  • A kind of bn-mir12 of ramie and its application
  • A kind of bn-mir12 of ramie and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Screening and identification of embodiment 1miRNA

[0021] 1. Plant Material and Sample Preparation

[0022] Treatment group: Take the young shoots (10-15cm) of Ramie Zhongzhu No. 1 variety, sterilize them with carbendazim for 10s, cut them in a water circulation device, and place them in an artificial climate greenhouse for cultivation. When the roots grow to 10cm, use 10mg / L concentration of For cadmium chloride treatment, fully expanded ramie leaves were collected after 20 days of treatment, and after liquid nitrogen quick freezing, they were frozen at -80°C for later use.

[0023] Control group: the cadmium chloride of 10 mg / L concentration in the treatment group was replaced with water, and the rest of the experimental conditions were unchanged, as a control group.

[0024] 2. High-throughput sequencing of ramie miRNA

[0025] RNA extraction: After the leaves were ground into powder in liquid nitrogen, RNA was extracted using the EASYspin plant microRNA rapid ext...

Embodiment 2

[0033] Example 2 Analysis of the expression level of Bn-miR12

[0034] 1. The preparation of plant materials and samples is the same as in Example 1.

[0035] 2. Bn-miR12 expression analysis

[0036] The extracted qualified RNA was used as the sample, and it was reverse-transcribed into the first strand of cDNA using the Specific Stem-loop RT Primer third-generation kit. The cDNA was used as the template, and the general reverse primer and forward primer F1 in the kit were used for reverse transcription. The expression of Bn-miR12 was detected by q-PCR, and the primer pair composed of F2 and R2 was used to detect 18SrRNA (internal reference gene) by q-PCR, and the relative expression of Bn-miR12 was calculated.

[0037] The specific operation steps are as follows:

[0038]1) RNA extraction: Take the sample stored at -80°C, grind it into powder with liquid nitrogen, take about 100 mg of the powder, quickly add 1 ml of refrigerated trizol, and homogenize for 2 minutes with a h...

Embodiment 3

[0064] Example 3 Analysis of the expression level of the target gene comp44118_c0 of Bn-miR12

[0065] 1. The preparation of plant materials and samples is the same as in Example 1.

[0066] 2. Expression analysis of Bn-miR12 target genes

[0067] Prepare the cDNA sample according to the method of 18SrRNA reverse transcription in Example 2, use the target gene forward primer F3: CTCGCAACTTTTCCAAAAACC (sequence 8) and reverse primer F3: TTGCTCTGTTTTTGGGCTCT (sequence 9) primer pair to amplify the target gene, using 18SrRNA as an internal reference Gene (forward primer F4: TGACGGAGAATTAGGGTTCGA (sequence 10); reverse primer F4: CCGTGTCAGGATTGGGTAATTT (sequence 11)), the expression of the target gene was detected on a Roche light cycler 480II PCR instrument, and the PCR reaction system and reaction procedure were the same as in Example 2 Medium 18SrRNA. The expression of the target gene as Figure 4 shown. The results showed that under cadmium stress, the expression level of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a ramie Bn-miR12 and its application. The nucleotide sequence of the Bn-miR12 is shown in sequence 1; the nucleotide sequence of its precursor sequence Bn-MIR12 is shown in sequence 2; the coding precursor The DNA sequence of sequence Bn-MIR12 is shown in sequence 3; the target gene comp44118_c0 regulated by ramie Bn-miR12 is shown in sequence 4. The up-regulated expression of Bn-miR12 in the ramie of the present invention can down-regulate the expression of its target gene comp44118_c0, thereby affecting the synthesis of auxin response factor 6 and promoting the absorption of cadmium, which has potential in the cultivation of cadmium super-enriched ramie varieties Value.

Description

technical field [0001] The invention relates to the technical field of botany, in particular to a ramie Bn-miR12 and application thereof. Background technique [0002] Cadmium is the most toxic heavy metal element. It not only affects the ecological structure and function of soil, but also inhibits the growth and development of crops, reduces yield and quality, and enters the human body through the food chain, causing various diseases and ultimately endangering human health. The area of ​​cultivated land polluted by cadmium in my country is nearly 13,300 hectares, and the scope of pollution involves 25 regions in 11 provinces, and the degree of pollution is increasing year by year. Planting crops that can absorb cadmium and reducing the content of cadmium in the soil is currently the most economical and effective way to deal with cadmium-contaminated soil. [0003] Ramie is an ancient natural fiber crop, and it is also a characteristic crop in my country. The cultivated are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11A01H5/00A01H6/84
CPCC12N15/113C12N15/8271C12N2310/141
Inventor 陈坤梅朱爱国喻春明熊和平陈继康高钢陈平
Owner INST OF BAST FIBER CROPS CHINESE ACADEMY OF AGRI SCI