Application of CTRP3 to preparation of drugs for preventing and treating cardiac hypertrophy

A technology for myocardial hypertrophy and drug, applied in the field of medicine, can solve problems such as heart failure, side effects, apoptosis, etc., and achieve the effects of preventing and treating myocardial hypertrophy, improving cardiac function, and delaying the occurrence of heart failure.

Inactive Publication Date: 2018-11-30
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The second stage is the decompensation period. Although the heart can be hypertrophied compensatoryly under the stimulation of hypertrophic factors to ensure that the blood supply function will not decline, when the stimulating factors continue to exist, the compensatory ability and energy consumption of cardiomyocytes reach the limit. , cardiomyocytes will produce pathological changes, even apoptosis, replaced by proliferating fibrous tissue, the number of cardiomyocytes will decrease, the function will decline, and myocardial fibrosis will aggravate, which will cause irreversible decline in cardiac contraction and pumping function, and eventually lead to heart failure.
At present, there are many drugs used to prevent and treat myocardial hypertrophy, but due to many problems such as specific mechanism of action, drug sources, side effects, etc., it is urgent to explore new safe and effective drugs for the prevention and treatment of myocardial hypertrophy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CTRP3 to preparation of drugs for preventing and treating cardiac hypertrophy
  • Application of CTRP3 to preparation of drugs for preventing and treating cardiac hypertrophy
  • Application of CTRP3 to preparation of drugs for preventing and treating cardiac hypertrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: expression, purification and identification of CTRP3

[0027] According to the open reading frame sequence of the human CTRP3 gene sequence (GenBank ACCESSION NM_030945.3), and codon optimization according to the codon preference of Escherichia coli, the whole gene synthesis was carried out (the sequence is:

[0028] ATGCACCATCATCATCATCATCAGGATGAGTATATGGAGTCTCCACAGACCGGTGGTCTGCCACCAGATTGCTCTAAGTGCTGTCATGGTGATTATTCATTCAGAGGTTACCAGGGTCCACCAGGTCCACCAGGACCACCAGGTATCCCAGGAAACCACGGTAATAACGGTAACAACGGTGCCACTGGTCATGAAGGTGCCAAAGGTGAGAAGGGTGACAAAGGTGATCTGGGTCCACGTGGTGAACGTGGTCAGCATGGTCCAAAGGGTGAAAAGGGTTACCCTGGTATTCCCCCTGAGCTGCAGATCGCTTTTATGGCCTCTCTGGCCACCCATTTCTCAAACCAGAACTCTGGTATTATTTTTTCATCTGTGGAAACCAACATTGGTAACTTCTTCGACGTGATGACCGGTCGTTTCGGTGCTCCAGTGTCTGGTGTGTACTTCTTCACCTTCTCTATGATGAAGCATGAGGACGTGGAAGAAGTTTACGTGTACCTGATGCACAACGGTAACACCGTGTTCTCTATGTATTCTTATGAAATGAAAGGTAAATCTGACACCTCTTCTAACCACGCCGTGCTGAAATTGGCCAAGGGTGATGAGGTGTGGCTGAGAATGGGTAACGGTGCCCTGCACGGTGATCATCAGCG...

Embodiment 2

[0031] Example 2: Administration of CTRP3 can reduce cardiomyocyte hypertrophy induced by phenylephrine

[0032] Clinically, there are many diseases that cause myocardial hypertrophy, the most common ones are primary or secondary hypertension, ischemic heart disease, and valvular disease. Cardiomyocyte hypertrophy models in vitro are mostly isolated from neonatal rat ventricular cardiomyocytes, and given phenylproterenol (PE), isoproterenol (ISO), angiotensin II (AngII), etc. to induce cardiomyocyte hypertrophy. PE, ISO or AngII can specifically induce cardiomyocyte hypertrophy, exclude the influence of fibroblasts, and simulate the hypertrophy process of cardiomyocytes. In the present invention, PE is used to stimulate neonatal rat cardiomyocytes in in vitro cell research, and a cardiomyocyte hypertrophy model is established for illustration.

[0033]Isolation and culture of cardiomyocytes: SD rats born 1-2 days old, sterilized twice with 75% alcohol, quickly removed the hea...

Embodiment 3

[0038] Embodiment 3: administration of CTRP3 can alleviate mouse myocardial hypertrophy in vivo animal model

[0039] C57BL / 6 mice (male, 8 weeks old, body weight 20-25 g) were anesthetized by isoflurane inhalation and fixed on the operating table. Under the assisted ventilation of the animal ventilator, the sternum was cut, and the tissue was separated. Under the microscope, the brachiocephalic trunk and the left common carotid artery were ligated and narrowed, and the chest was closed to exhaust the air, and the aortic arch constriction operation (TAC operation) was completed. The treatment group was intraperitoneally given CTRP3 recombinant protein at 0.25 μg / g body weight. Dosing was started immediately after coarctation of the aortic arch.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of CTRP3 to preparation of drugs for preventing and treating cardiac hypertrophy. A pathologic hypertrophy model of cells is established in the invention, and the pathologic hypertrophy model proves that administration of CTRP3 can lower the expression of cardiac hypertrophy marker molecules and reduce the average surface area of cardiac muscle cells. An in-vivo animal model is also established in the invention, and the in-vivo animal model proves that after administration of CTRP3, the heart-to-body ratio and the lung-to-body ratio of a mouse significantly decrease, the left ventricular systolic function of the heart of the mouse is significantly improved; interventricular septal thickness in a systolic period and left ventricular posterior wall thickness in a diastolic period are significantly reduced; the cross-sectional areas of myocardial cells significantly decrease; the myocardial cells are arranged more closely and regularly; the degreesof myocardial tissue interstitial fibrosis and pericapillary fibrosis are greatly lowered; and thus, it is indicated that CTRP3 has significant prevention effect on pathological cardiac hypertrophy, delays the occurrence of heart failures, and has good clinical application prospects.

Description

technical field [0001] The invention belongs to the technical field of medicine, and specifically relates to the application of CTRP3 for preparing and preventing pathological myocardial hypertrophy and delaying the occurrence of heart failure. Background technique [0002] Under the action of pressure load, inflammation, oxidative stress and other stimuli, the heart produces a series of changes in gene expression, appearance and cardiac function. These stimuli can either directly stimulate cardiomyocyte hypertrophy or activate signaling pathways Induce overexpression of hypertrophy-related genes, causing cardiac hypertrophy. [0003] Pathological myocardial hypertrophy manifests as a significant increase in heart mass and volume, mostly increased thickness in the middle of the posterior ventricular wall and interventricular septum, narrow cardiac chambers, enlarged cardiomyocyte nuclei, increased cell volume, increased diameter or length, and disordered intercellular arrang...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/19A61P9/00A61P9/04
CPCA61K38/191A61P9/00A61P9/04
Inventor易蔚刘金成孙阳张冰谭延振易定华赵达君冯攀张正斌朱丽雯
OwnerFOURTH MILITARY MEDICAL UNIVERSITY