Application of CTRP3 to preparation of drugs for preventing and treating cardiac hypertrophy
A technology for myocardial hypertrophy and drug, applied in the field of medicine, can solve problems such as heart failure, side effects, apoptosis, etc., and achieve the effects of preventing and treating myocardial hypertrophy, improving cardiac function, and delaying the occurrence of heart failure.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1: expression, purification and identification of CTRP3
[0027] According to the open reading frame sequence of the human CTRP3 gene sequence (GenBank ACCESSION NM_030945.3), and codon optimization according to the codon preference of Escherichia coli, the whole gene synthesis was carried out (the sequence is:
[0028] ATGCACCATCATCATCATCATCAGGATGAGTATATGGAGTCTCCACAGACCGGTGGTCTGCCACCAGATTGCTCTAAGTGCTGTCATGGTGATTATTCATTCAGAGGTTACCAGGGTCCACCAGGTCCACCAGGACCACCAGGTATCCCAGGAAACCACGGTAATAACGGTAACAACGGTGCCACTGGTCATGAAGGTGCCAAAGGTGAGAAGGGTGACAAAGGTGATCTGGGTCCACGTGGTGAACGTGGTCAGCATGGTCCAAAGGGTGAAAAGGGTTACCCTGGTATTCCCCCTGAGCTGCAGATCGCTTTTATGGCCTCTCTGGCCACCCATTTCTCAAACCAGAACTCTGGTATTATTTTTTCATCTGTGGAAACCAACATTGGTAACTTCTTCGACGTGATGACCGGTCGTTTCGGTGCTCCAGTGTCTGGTGTGTACTTCTTCACCTTCTCTATGATGAAGCATGAGGACGTGGAAGAAGTTTACGTGTACCTGATGCACAACGGTAACACCGTGTTCTCTATGTATTCTTATGAAATGAAAGGTAAATCTGACACCTCTTCTAACCACGCCGTGCTGAAATTGGCCAAGGGTGATGAGGTGTGGCTGAGAATGGGTAACGGTGCCCTGCACGGTGATCATCAGCG...
Embodiment 2
[0031] Example 2: Administration of CTRP3 can reduce cardiomyocyte hypertrophy induced by phenylephrine
[0032] Clinically, there are many diseases that cause myocardial hypertrophy, the most common ones are primary or secondary hypertension, ischemic heart disease, and valvular disease. Cardiomyocyte hypertrophy models in vitro are mostly isolated from neonatal rat ventricular cardiomyocytes, and given phenylproterenol (PE), isoproterenol (ISO), angiotensin II (AngII), etc. to induce cardiomyocyte hypertrophy. PE, ISO or AngII can specifically induce cardiomyocyte hypertrophy, exclude the influence of fibroblasts, and simulate the hypertrophy process of cardiomyocytes. In the present invention, PE is used to stimulate neonatal rat cardiomyocytes in in vitro cell research, and a cardiomyocyte hypertrophy model is established for illustration.
[0033]Isolation and culture of cardiomyocytes: SD rats born 1-2 days old, sterilized twice with 75% alcohol, quickly removed the hea...
Embodiment 3
[0038] Embodiment 3: administration of CTRP3 can alleviate mouse myocardial hypertrophy in vivo animal model
[0039] C57BL / 6 mice (male, 8 weeks old, body weight 20-25 g) were anesthetized by isoflurane inhalation and fixed on the operating table. Under the assisted ventilation of the animal ventilator, the sternum was cut, and the tissue was separated. Under the microscope, the brachiocephalic trunk and the left common carotid artery were ligated and narrowed, and the chest was closed to exhaust the air, and the aortic arch constriction operation (TAC operation) was completed. The treatment group was intraperitoneally given CTRP3 recombinant protein at 0.25 μg / g body weight. Dosing was started immediately after coarctation of the aortic arch.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



