Kit for rapidly identifying dog skin and cat skin component contained objects carried with entry-exit passengers
A technology for entry-exit and kits, applied in biochemical equipment and methods, microbiological measurement/inspection, etc., can solve the problems of slow inspection speed, complicated inspection methods, and inaccurate results, and achieve non-degradable, easy extraction, and preparation simple effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] The primer set design and selection of the kit for rapidly detecting prohibited components in leather goods carried by inbound and outbound passengers
[0042] 1. Design primers:
[0043] (1) Retrieve the cat's Cytb gene sequence from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 8)
[0044] (2) Retrieve the dog's Cytb gene sequence from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 7)
[0045] (3) Retrieve the Cytb gene sequence of sheep from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 9)
[0046] (4) Retrieve the Cytb gene sequence of cattle from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 10)
[0047] (5) Retrieve the horse Cytb gene sequence from GenBank to determine the accuracy of the sequence. The sequence is as follows: (SEQ IDNO 11)
[0048] (6) According to the above sequence, the MEG software ...
Embodiment 2
[0066] LF
[0067] ATATAGAAGCTCCGTTGGCGTGT
[0068] LB
[0069] CTTCTCAGAGACATGAAACATTGGA
[0052] Primer set 2:
[0053] [0072] Primer
[0073] Sequence (5'→3')
[0074] F3
Embodiment 3
[0076] B3
[0077] GGAGCCGTAGTACATTCC
[0078] FIP
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com