Human DPP4 gene knock-in mouse model and production method and use thereof

A gene knock-in, mouse model technology, applied in other methods of inserting foreign genetic materials, biochemical equipment and methods, genetic engineering, etc.

Active Publication Date: 2018-12-18
NAT INST FOR FOOD & DRUG CONTROL
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As far as the inventor knows, this design of the present invention has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human DPP4 gene knock-in mouse model and production method and use thereof
  • Human DPP4 gene knock-in mouse model and production method and use thereof
  • Human DPP4 gene knock-in mouse model and production method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0146] Example 1. Construction of targeting vector comprising hDPP4 gene

[0147]Human dipeptidyl peptidase 4 (hDPP4) is the receptor of MERS-CoV, which has the ability to mediate the infection of hosts by MERS-CoV. Mouse dipeptidyl peptidase 4 (mDPP4) is not a functional receptor for MERS-CoV, therefore, MERS-CoV cannot infect mice via mDPP4.

[0148] In this example, a targeting vector containing the hDPP4 gene was constructed for knocking the hDPP4 gene into the Rosa26 locus of the mouse genome and expressing the hDPP4 protein, aiming to obtain gene knock-in mice capable of infecting MERS-CoV.

[0149] The targeting vector contains 5' homology arm, splicing acceptor (splicing acceptor, SA), hDPP4 gene, internal ribosome entry site (IRES) sequence, tdTomato reporter gene, woodchuck hepatitis virus post-transcriptional regulatory element (woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)), poly A sequence, 3' homology arm; wherein said 5' homology arm a...

Embodiment 2

[0153] Example 2. Generation of mice with targeted knock-in of the hDPP4 gene at the target site of the Rosa26 locus

[0154] The targeting vector comprising the hDPP4 gene constructed in Example 1, the sgRNA efficiently targeting the Rosa26 locus (comprising the nucleotide sequence TAGGCCGCACCCTTCTCCGG shown in SEQ ID NO: 2 and the nucleotide sequence AAACCCGGAGAAGGGTGCGG shown in SEQ ID NO: 3 ) and Cas9 mRNA sequences known in the prior art (for example, the Cas9 mRNA sequence encoding the amino acid sequence shown in SEQ ID NO: 6) were microinjected into 294 C57BL / 6 mouse zygotes, and then the zygotes were implanted Pseudo-pregnant surrogate mice were pregnant in KM mice or ICR mice, and offspring were born from surrogate mice. A total of 41 offspring were obtained.

[0155] For 41 offspring of surrogate mice, the primer hDpp4 forward primer: 5'-CTGCAGTACCCAAAGACTGTACGGG-3' (SEQ ID NO: 4); hDpp4 reverse primer: 5'-GACACCTTTTCCGGATTCAGCTCACA-3' (SEQ ID NO: 5) Genotyping wa...

Embodiment 3

[0158] Example 3. Detection of hDPP4 gene expression and immune system detection in R26-hDPP4 mice

[0159] The expression of hDPP4mRNA in R26-hDPP4 mice was detected by reverse transcription polymerase chain reaction (RT-PCR). figure 1 D shows that significant expression of hDPP4 mRNA can be detected in lung, brain, heart, liver, kidney, and intestine. Western blotting of lung and brain tissues confirmed the expression of hDPP4 protein ( figure 1 E). The R26-hDPP4 mice of the present invention have the highest expression of hDPP4 in the lung. Benefiting from the tdTomato gene inserted after the hDPP4 gene, the expression pattern of hDPP4 in mouse tissue and whole body was visualized by bioluminescent imaging (BLI) ( figure 1 F).

[0160] The expressions of IL-12, TNF-α, INF-γ, MCP-1, IL-10 and IL-6 in R26-hDPP4 mice were detected by flow cytometry and the corresponding cytokines in wild-type C57BL / 6 mice expression was comparable, suggesting that insertion of human DPP4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a human DPP4 gene knock-in mouse model and a production method and use thereof. Specifically, human DPP4 is accurately inserted into a safe harbor locus of a mouse genome without changing mouse DPP4 function to establish a novel homozygous mouse model in which a human DPP4 gene is knocked into the mouse safe harbor locus. The invention also provides the use of the mouse model in which the human DPP4 gene is knocked into the genome in infection of a mouse with a low dose MERS-CoV euvirus in a BSL-3 facility and evaluation of the in-vivo efficacy of anti-MERS-CoV antiviral agents and vaccines or infection of the mouse with pseudotype MERS-CoV virus in a biological laboratory lacking the BSL-3 facility and evaluation of the in-vivo efficacy of the anti-MERS-CoVantiviral agents and vaccines.

Description

Technical field: [0001] The present invention relates to a mouse in which human dipeptidyl peptidase 4 (hDPP4) gene is knocked in, its production method and application. Specifically, the present invention accurately inserts the hDPP4 gene into the safe harbor (safe harbor) locus in the mouse genome without changing the function of mouse dipeptidyl peptidase 4 (mDPP4). A novel knock-in mouse model homozygous for the hDPP4 gene at the Hong Kong locus. The hDPP4 knock-in mice are genetically stable and can be infected with low doses of MERS-CoV true virus in a biosafety level-3 (biosafety level-3; BSL-3) facility and evaluated against MERS-CoV. In vivo efficacy of antiviral agents and vaccines for CoV It is also possible to use pseudotyped MERS-CoV virus to infect the mice and evaluate the in vivo efficacy of antiviral agents and vaccines in a biological laboratory lacking BSL-3 facilities. Background technique [0002] Most coronaviruses that infect humans cause mild upper ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N9/22A01K67/027
CPCA01K67/0278C12N9/22C12N15/907A01K2267/0337A01K2227/105
Inventor王佑春范昌发吴曦刘强李倩倩黄维金刘甦苏吕建军杨艳伟曹愿
OwnerNAT INST FOR FOOD & DRUG CONTROL