Method for synthesizing fatty alcohol acetates base on fatty acids in microorganisms in vivo

A technology for fatty acid synthesis and alcohol acetate, applied in the field of microbial genetic engineering, can solve the problem of high synthesis cost, achieve the effects of fast growth, mature genetic manipulation technology and reduced release

Active Publication Date: 2019-01-18
GANNAN NORMAL UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The chemical synthesis of sex pheromones involves multiple reaction steps, resulting in high synthesis costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing fatty alcohol acetates base on fatty acids in microorganisms in vivo
  • Method for synthesizing fatty alcohol acetates base on fatty acids in microorganisms in vivo
  • Method for synthesizing fatty alcohol acetates base on fatty acids in microorganisms in vivo

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1 is based on fatty acyl ACP as the precursor molecule to produce fatty alcohol acetate Escherichia coli engineering bacteria ( figure 1 shown)

[0024] Construction of Fatty Alcohol-Producing Engineering Bacteria

[0025] 1. Utilize primers AAR-XbaI (GTATCTAGAAAGAGGAGATATAATGTTCGGTCTTATCGGTCATCTC) and AAR-SpeI-BamHI (TGTGGATCCACTAGTTCAAATTGCCAATGCCAAGG) to PCR amplify the AAR gene from Synechococcuselongates bacteria, then insert the amplified fragment into pET28a (+) with XbaI and BamHI to obtain vector pDY01. The AHR gene from Escherichia coli was amplified by PCR using primers AHR-XbaI (ATATCTAGAAAGAGGAGATATAATGTCGATGATAAAAAAGCTATGCCG) and AHR-SpeI-BamHI (GTAGGATCCACTAGTTCAAAAATCGGCTTTCAACACCAC), and inserted into pET28a(+) using XbaI and BamHI to obtain vector pDY02. The AAR expression cassette was obtained by double-digesting pDY01 with XbaI and XhoI, and inserted into the vector pDY02 double-digested with SpeI and XhoI to obtain the recombinant vector p...

Embodiment 2

[0030] Embodiment 2 is based on the construction of fatty acid as a precursor molecule to produce fatty alcohol acetate Escherichia coli engineering bacteria ( figure 1 shown)

[0031] Construction of Fatty Alcohol-Producing Engineering Bacteria

[0032] 1. Utilize primers CAR-XbaI (ATATCTAGAAAGAGGAGATATAATGTCGCCAATCACGCGTGA) and CAR-SpeI-BamHI (AGAGGATCCACTAGTTCAGAGCAGGCCGAGTAGGC) to PCR amplify the CAR gene from Mycobacterium marinum bacteria, and then insert the amplified fragment into pET28a (+) with XbaI and BamHI to obtain vector pDY06. The 'TesA gene from Escherichia coli was amplified by PCR with primers 'TesA-SacI (AGATGAGCTCATGGCGGACACGTTATTGATTCTGG) and 'TesA-SpeI (TGTACTAGTTTATGAGTCATGATTTACTAAAGGCTGC), and then the amplified fragment was double-digested with SacI and SpeI and inserted into pBBR1MCS1 to obtain vector pDY07. The AHR gene from Escherichia coli was amplified by PCR using primers AHR-BamHI (ACTGGATCCAAGAAGGAGATATAATGTCGATGATAAAAAAGCTATGCCG) and AHR-Xh...

Embodiment 3

[0037] Example 3 Construction based on fatty acyl-ACP and fatty acyl-CoA as precursor molecules to produce fatty alcohol acetate Escherichia coli engineering bacteria ( figure 1 shown)

[0038] Construction of Fatty Alcohol-Producing Engineering Bacteria

[0039] 1. Use primers FAR-XbaI (CAATCTAGAAAGAGGAGATATAATGGCAATACAGCAGGTACATCAC) and FAR-SpeI-BamHI (CGAGGATCCACTAGTTCAGGCAGCTTTTTTGCGCT) to PCR amplify the FAR gene from M.aquaolei bacteria, then insert the amplified fragment into pET28a(+) with XbaI and BamHI to obtain the vector pDY11.

[0040] 2. The recombinant vector pDY11 was introduced into Escherichia coli GM1655 to obtain GDY5 engineering bacteria. The engineering bacterium realizes the high expression of the FAR gene. The FAR enzyme was expressed to catalyze the direct reduction of fatty acid synthesis intermediates acyl-ACP and acyl-CoA to fatty alcohols.

[0041] Construction of Engineering Bacteria Producing Fatty Alcohol Acetate

[0042] 1. The vector pDY1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for synthesize pheromone fatty alcohol acetate ester based on three intermediate product of fatty acid metabolism pathway in microorganism includes such steps as high expression of fatty acidacyl ester in microorganism, high expression of fatty acid acyl ester in microorganism, high expression of fatty acid acyl ester in microorganism, high expression of fatty acid acyl ester in microorganism, high expression of fatty acid acyl ester in microorganism, high expression of fatty acid acyl ester in microorganism, and high expression of fatty acid acyl ester in microorganism. ACP reductase AAR, carboxylic acid reductase CAR, acyl-CoA reductase FAR and aldehyde reductase AHR, respectively. ACP, fatty acid or acyl-CoA producing fatty alcohol. At last, the pheromone fatty alcohol acetatewas synthesized by the reaction of fatty alcohol and acetyl-CoA with high expression of alcohol acetyltransferase ATF1 in fatty alcohol-producing engineering bacteria. The invention can realize microbial conversion from glucose to fatty alcohol acetate, and provides a feasible path for large-scale biosynthesis of fatty alcohol acetate.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to a method for directly synthesizing pheromone fatty alcohol acetate from monosaccharide by transforming microbial metabolic pathway. Background technique [0002] 1. Insect sex pheromones, also known as sex pheromones (artificially synthesized and used to control pests, are also called sex attractants), are secreted in vitro by special organs of a certain sex of the same insect, and can be absorbed by individuals of the same sex. Trace chemical substances that are accepted by the receptors and cause corresponding behavioral responses or physiological effects (such as mate seeking, directional courtship, mating, etc.). So far, about 2000 kinds of insect sex pheromones have been identified, most of which are various fatty alcohol acetate molecules. At present, a few insect sex pheromones have been chemically synthesized. Since the application of insect pher...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/53C12N15/54C12N15/55C12P7/62
CPCY02E50/10
Inventor郭道义潘虹李勋李永东范小林
OwnerGANNAN NORMAL UNIV