Pasteurella multocida gene knockout strain mediated by ngpiwi protein and its construction method and application

A Pasteurella and gene knockout technology, applied in the field of avian Pasteurella multocida gene knockout strains and their construction, can solve the problem of not being able to produce better cross-immune protection, lagging behind in attenuated vaccine research, and ineffective weakening mechanisms. Clear and other problems, to achieve the effect of good immune protection efficiency, significant reduction in virulence, and high screening efficiency

Active Publication Date: 2021-08-24
HUAZHONG AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] 1) Conventional inactivated vaccines generally use the popular virulent strains of Pasteurella avian to prepare whole-bacteria inactivated vaccines, as well as pasteurella multocida of serum A:1, A:3 and A:4 types Trivalent oil-emulsion inactivated vaccines are made, and propolis dual inactivated vaccines are made from Pasteurella poultry and E. There is no good cross-immune protection, and it only has the effect of immune protection against the infection of strains of the same serotype
[0006] 2) Traditional attenuated live Pasteurella avian vaccines mainly include clinically isolated attenuated strains and attenuated strains weakened by physical and chemical mutagenesis. Wide range and low production cost, but because the weakening mechanism is not clear, there is a risk of strong virulence
[0011] Due to the difficulty of knocking out the genes in the genome of Pasteurella multocida, the study of genetically engineered attenuated vaccines against Pasteurella multocida lags behind

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pasteurella multocida gene knockout strain mediated by ngpiwi protein and its construction method and application
  • Pasteurella multocida gene knockout strain mediated by ngpiwi protein and its construction method and application
  • Pasteurella multocida gene knockout strain mediated by ngpiwi protein and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0141] The specific method for constructing the temperature-sensitive suicide basic plasmid pSHK5Ts-NgPiwi for knocking out the target gene of Pasteurella multocida comprising the following steps:

[0142] 1) Using SEQ ID No.6 and SEQ ID No.7 as templates to design NgPiwi fragments and RBS fragment amplification fusion primers and identification primers for NgPiwi fragments; respectively:

[0143] NgPiwi forward and reverse amplification primers:

[0144] NgPiwi-L: ATGACAGTGATTGACCTCGATTCG,

[0145] NgPiwi-RH-R: GCAAGAAAAAATATCAATTAGAGGAATCCGACAT;

[0146] Forward and reverse amplification primers for RBS:

[0147] RBS-RH-L: TGTCGGATTCCTCTAATTGATATTTTTTTCTTGC,

[0148] RBS-R: TATGCACTCCTATTTATTTAACTAAGTTGAC;

[0149] Primers to identify NgPiwi fusions to the plasmid:

[0150] NgPiwi-JD-F: CAACCCGGTAAGACACGACTTATC,

[0151] NgPiwi-JD-R: ATCTGTAACATCATTGGCAACGC;

[0152] 2) Fusion primers were designed using the temperature-sensitive suicide plasmid pSHK5Ts and NgPiwi-RBS...

Embodiment 2

[0195] The acquisition of the P. multocida hyae gene ORF partial sequence deletion bacterial strain △hyae-GX-PM comprises the following steps:

[0196] 1) Using the ORF sequence of the capsular synthetic protein gene + 300bp sequences upstream and downstream (referred to as the ORF sequence of the hyae gene and the 300bp sequences upstream and downstream) as shown in SEQ ID No.8 as a template, design primers to knock out the partial sequence of the hyae gene ORF , respectively:

[0197] Left homology arm forward and reverse primers:

[0198] hyaE-KpnI-L-1: CATGGTACCGGTTATTATCATTGGAC,

[0199] hyaE-L-2: AACAGATGCAGTGAGATCTTGGTTTACTTCAATAATTTCC;

[0200] Right homology arm forward and reverse primers:

[0201] hyaE-R-3: TGAAGTAAACCAAGATCTCACTGCATCTGTTCAATC,

[0202] hyaE-SacI-R-4: AAAGAGCTCGAGTAAGCCACTTAAACGG;

[0203] Primers on both sides of the left and right homology arms of the ORF partial sequence of the hyae gene to be deleted on the genome:

[0204] hyaE-ID-F: CCTA...

Embodiment 3

[0257] The acquisition of the Pasteurella multocida lyi gene ORF sequence deletion strain Δlyi-GX-PM, the main steps are the same as in Example 2, and the differences include the following steps:

[0258] 1) Using the lyi ORF sequence and the upstream and downstream 1000bp sequences, as shown in SEQ ID No.9, as a template, design primers for knocking out the lyi gene ORF sequence, respectively:

[0259] Left homology arm forward and reverse primers:

[0260] lyi-SacI-L1:AAGAGCTCAGATGTTATTGAGTCTGCG,

[0261] lyi-RH-L2: TTTAGGAGTTTTTTATGTAAGTCAATACTGATC;

[0262] Right homology arm forward and reverse primers:

[0263] lyi-RH-R3: TGATCAGTATTGACTTACATAAAAACTCCTAAATTC,

[0264] lyi-BamHI-R4: TTGGATCCTGACTTTGTCTTTAACACTGC;

[0265] Primers on both sides of the left and right homology arms of the lyi gene ORF sequence to be deleted on the genome:

[0266] lyi-ID1F: TGGTGGCGTTGACTCTTCTGTCAC,

[0267] lyi-ID1R: AAATTACGAGCGATGGCCTCG;

[0268] Primers for internal identification...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Ngpiwi protein-mediated Pasteurella multocida gene knockout strain and its construction method and application; The deletion strain of the ORF sequence or partial sequence of potential virulence-related genes on the Bacillus genome. This method first successfully constructs a recombinant plasmid with Ngpiwi and the left and right homology arms of the target gene sequence to be deleted; secondly, the recombinant plasmid is electrotransformed into Pasteurella avium multocida, passaged at 28°C to induce double-crossover recombination, and PCR screening out The strain lacking the target gene sequence was then induced to lose the plasmid at 42°C, so as to obtain the strain lacking the sequence related to the potential virulence gene. The genetic operating system has small plasmids, easy operation, wide application, no potential off-target effects, high knockout efficiency, and no resistance gene selection markers. tool.

Description

technical field [0001] The invention relates to the technical field of veterinary biological products, in particular to a Ngpiwi protein-mediated knockout strain of Pasteurella multocida gene in poultry and its construction method and application. Background technique [0002] Fowl cholera is a hemorrhagic and septic infectious disease caused by Pasteurella multocida infecting poultry. The morbidity and mortality are very high, and death occurs within 1-3 days. Fowl cholera is a severe disease in chicken farms in some areas of my country, often causing serious economic losses, and is one of the most serious infectious diseases to the poultry industry. In October 2011, Yu Chengjie et al. isolated a strain of Pasteurella multocida with capsular genotype A type from laying hens in a chicken farm in Guangxi, and named it GX-PM. Animal regression experiments showed that the strain It is highly pathogenic to chickens, and 100 CFU can cause all 10-week-old chickens to die within 3...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/74C12N15/66A61K39/102A61P31/04C12R1/01
CPCA61K39/102A61K2039/522A61P31/04C07K14/285C12N15/66C12N15/74
Inventor张安定付磊韩丽项耀祖靳泽华
OwnerHUAZHONG AGRI UNIV