Application of a Highly Expressed Indica-type Promoter in Japonica Rice
A technology of promoter and high expression, applied in the application field of indica type promoter in japonica rice
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Construction of the promoter-GUS transgenic plant of embodiment 1 OsAAP4 gene
[0019] Genome-wide Association analyzes provide genetic and biochemical insights into natural variation in ricemetabolism.Nat.Genet.46,20-20.) DNA, using amplification primer F (TTAAGCTTATGGTGCTATCCCATTTATTTGGAGGA, SEQ ID NO.3) and amplification primer R (TTGGATCCGCCGATGCACAAGCCACCCAA, SEQ ID NO.3) NO.4) After amplifying the indica-type and japonica-type promoter sequences of the OsAAP4 gene by PCR (the indica-type and japonica-type promoter sequences of the OsAAP4 gene are respectively shown in SEQ ID NO.1 and 2), use HindIII and BamHI Restriction digestion and connection into pCAMBIA-1391Z vector, two types of promoter-GUS expression vectors were constructed. Using the genetic transformation method mediated by Agrobacterium EHA105, the two promoter-GUS expression vectors were introduced into the japonica rice variety Zhonghua 11 by transforming the callus induced by mature rice embryos. ...
Embodiment 2
[0021] Example 2 Detection of promoter-GUS expression activity in different parts of two kinds of transgenic plants
[0022] GUS staining was performed on different parts of the homozygous transgenic plants of the T2 generation at the tillering and reproductive stages. The specific process was as follows: After harvesting the successfully identified T2 generation seeds, they were soaked in water and cultured in a constant temperature incubator at 37 °C. When the buds of the seeds grow to about 2 cm, they are sown into 96-well plates, and they are hydrocultured with full nutrient solution under the light of the greenhouse. When the seedlings are young, they are cultured with rice nutrient solution. When the seedlings grow to about 20cm, they are transplanted into the soil and cultivated under light in the greenhouse. During the tillering and reproductive stages, perform GUS staining on plant root tips, roots with just long lateral roots, roots with more lateral roots, young til...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

