Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of a Highly Expressed Indica-type Promoter in Japonica Rice

A technology of promoter and high expression, applied in the application field of indica type promoter in japonica rice

Active Publication Date: 2021-10-08
WUHAN INST OF BIOENG
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the research on rice AAP family members. The protein of the rice amino acid transport family OsAAP3 gene can transport various amino acids such as lysine and arginine (Taylor M R, Reinders A, WardJ M. Transport function of rice amino acid permeases (AAPs)[J].Plant and Cell Physiology,2015,56(7):1355-1363.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a Highly Expressed Indica-type Promoter in Japonica Rice
  • Application of a Highly Expressed Indica-type Promoter in Japonica Rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Construction of the promoter-GUS transgenic plant of embodiment 1 OsAAP4 gene

[0019] Genome-wide Association analyzes provide genetic and biochemical insights into natural variation in ricemetabolism.Nat.Genet.46,20-20.) DNA, using amplification primer F (TTAAGCTTATGGTGCTATCCCATTTATTTGGAGGA, SEQ ID NO.3) and amplification primer R (TTGGATCCGCCGATGCACAAGCCACCCAA, SEQ ID NO.3) NO.4) After amplifying the indica-type and japonica-type promoter sequences of the OsAAP4 gene by PCR (the indica-type and japonica-type promoter sequences of the OsAAP4 gene are respectively shown in SEQ ID NO.1 and 2), use HindIII and BamHI Restriction digestion and connection into pCAMBIA-1391Z vector, two types of promoter-GUS expression vectors were constructed. Using the genetic transformation method mediated by Agrobacterium EHA105, the two promoter-GUS expression vectors were introduced into the japonica rice variety Zhonghua 11 by transforming the callus induced by mature rice embryos. ...

Embodiment 2

[0021] Example 2 Detection of promoter-GUS expression activity in different parts of two kinds of transgenic plants

[0022] GUS staining was performed on different parts of the homozygous transgenic plants of the T2 generation at the tillering and reproductive stages. The specific process was as follows: After harvesting the successfully identified T2 generation seeds, they were soaked in water and cultured in a constant temperature incubator at 37 °C. When the buds of the seeds grow to about 2 cm, they are sown into 96-well plates, and they are hydrocultured with full nutrient solution under the light of the greenhouse. When the seedlings are young, they are cultured with rice nutrient solution. When the seedlings grow to about 20cm, they are transplanted into the soil and cultivated under light in the greenhouse. During the tillering and reproductive stages, perform GUS staining on plant root tips, roots with just long lateral roots, roots with more lateral roots, young til...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a high-expression indica type promoter in japonica rice, and belongs to the field of plant genetic engineering. The promoter involved in the present invention is the OsAAP4 gene indica type promoter, and its sequence is shown in SEQ ID NO.1. In the present invention, by respectively constructing OsAAP4 gene indica-type and japonica-type promoter-GUS transgenic plants, and mutually detecting and comparing the expression activity of GUS, it is found that the indica-type promoter of the gene is more active than the japonica-type promoter in each tissue part of japonica rice, It can strongly promote the strong expression of downstream genes in multiple parts of japonica rice. Applying the indica-type promoter of the OsAAP4 gene to the japonica-type rice transgenic project can promote the expression of downstream genes in each growth stage of japonica rice, and can also specifically accumulate or enrich the expression products of other target genes, improving the gene expression in rice. Therefore, the promoter has a good application prospect in transgenic engineering.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of a high-expression indica type promoter in japonica rice. Background technique [0002] Plants obtain nitrogen by absorbing ammonia, nitrate, amino acids, soluble peptides, etc. in the soil; nitrogen absorption and transport mainly rely on ammonium transport protein (AMT), nitrate transport protein (NRT), amino acid transport protein (AAT) , Peptide Transporter (PTR) and other transport proteins (Williams L, Miller A. Transporters responsible for the uptake and partitioning of nitrogenous solutes. Annu Rev Plant Biol and Plant Mol Biol, 2001, 52:659-688.). Ammonium is absorbed by plant AMT and then synthesized glutamine and glutamate by glutamine synthase (GS) and glutamate synthase (GOGAT), which are further formed into other amino acids (Sonoda Y, Ikeda A, Saiki S , et al. Feedback regulation of the ammonium transporter gene family AMT1 by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8216
Inventor 方中明吴博文赵一舟万芳伟黄慧霞
Owner WUHAN INST OF BIOENG