Construction method and application of annular RNA overexpression system of protoplast of moso bamboo

A protoplast and construction method technology, applied in the field of genetic engineering, can solve the problems of difficult to see the influence of circular RNA, great difficulty, and long time-consuming, and achieve the effect of saving economic costs, saving time, and stabilizing instantaneous transformation

Active Publication Date: 2019-03-19
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The correlation between the host gene that produces circular RNA and the expression of circular RNA has always been a focus of attention, and molecular cloning technology is of great significance for the study of this issue, but unfortunately for forest tree species, especially Moso bamboo Said that because traditional genetic transformation takes too long and is difficult, it is difficult to see the impact of circular RNA on the transcription level of its host genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of annular RNA overexpression system of protoplast of moso bamboo
  • Construction method and application of annular RNA overexpression system of protoplast of moso bamboo
  • Construction method and application of annular RNA overexpression system of protoplast of moso bamboo

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Extraction of Moso bamboo nucleic acid

[0040] (1) Material handling

[0041] Select bamboo shoots of 0.2 cm in the aboveground part of moso bamboo, cut the middle part with a scalpel, wrap it in tin foil, and put it in liquid nitrogen quickly. The material was ground using a high-throughput tissue grinder (QIAGEN TissueLyser II) and stored at -80°C.

[0042] (2) Extraction of Genomic DNA and Total RNA of Phyllostachys pubescens

[0043] Take 150 mg of the above ground sample, use Plant Genomic DNA Kit (TIANGEN, no. DP305, China) to extract the Genomic DNA of bamboo shoots; use RNAprep Pure Plant Kit (Polysaccharides&Polyphenolics-rich) (TIANGEN, no. DP441, China) to extract Total RNA. Total RNA is used for circular RNA verification, and DNA is used for vector construction and host gene amplification.

[0044] (3) RNA reverse transcription

[0045] Using PrimeScript ™ II 1st Strand cDNA Synthesis Kit (TaKaKa, no.6210A), 1 ug of Total RNA was reverse-tran...

Embodiment 2

[0046] Example 2 Verification of circular RNA

[0047] According to the transcriptome data, nine circular RNA sequences were obtained, the sequences of which are shown in SEQ ID NO: 1 to SEQ ID NO: 9, and the "back-to-back" primers designed by the PRAPI software were used to verify the circular RNAs. The primer sequences are shown in Table 1.

[0048] 20 μg Total RNA (adjusted to 51 μL volume) was evenly divided into two tubes, one tube was treated with RNase R digestion, and the other tube was used as a control. Add 3 μL 10×RNase R Reaction Buffer, 1.5 μL RNase R (20U / uL) to the treatment tube; add 3 μL 10×RNase R Reaction Buffer, 1.5 μL RNase-freewater to the control tube. Incubate the treatment tube and the control tube in a water bath at 37 °C for 15 min, then add 30 μL of phenol-chloroform-isoamyl alcohol (25:24:1) to the two tubes to terminate the reaction, mix well, 4 °C, 13,000 g Centrifuge for 5 min. Transfer the supernatant to a new 1.5 mL RNase-free centrifuge tub...

Embodiment 3

[0050] Example 3 Construction of circular RNA overexpression recombinant plasmid

[0051] (1) Amplification of the target gene

[0052] The PH01000724G0700 (PH01000724:425581-426013) host gene was selected as the target gene. Design the 5' end of the target gene with attB- Specific primers for site adapters. The specific primer sequences are as follows:

[0053] The forward primer is: SEQ ID NO:28:

[0054] 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTT CGTAAGTGGACGAAACACAAGAAG

[0055] AA-3' reverse primer is: SEQ ID NO:29:

[0056] 5' GGGGACCACTTTGTACAAGAAAGCTGGGTC CTTTTACCCCGTCAATCAAACCTTA-3'

[0057] The bold underlined part is attB recognition site.

[0058] Taking the Genomic DNA of Moso bamboo as a template, the above bands attB- 2.5 μL each for the forward and reverse primers of the adapter, 2×Unique HiQ TM Pfu Master Mix (No Dye) (Novogene, no. NHP007L, China) 25 μL, add ddH 2 0 to 50 μL system, 34 PCR cycles were performed at 98°C for 10 s, 58°C for 20 s, and 72°...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and an application of an annular RNA overexpression system of protoplast of moso bamboo and belongs to the technical field of genetic engineering. The system constructs an annular RNA overexpression vector and converts the vector to the protoplast of moso bamboo. The construction method comprises the following steps: amplifying an annular RNA host genewith a high fidelity Taq enzyme and constructing an annular RNA overexpressed recombinant plasmid by a Gateway method by taking pUC19-35s-sGPF as a final vector; and extracting the recombinant plasmids massively and converting the plasmids to the protoplast of moso bamboo mediated by PEG to research the influence of annular RNA overexpression to transcription and post-transcription levels of thehost gene.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for constructing a protoplast circular RNA overexpression system of moso bamboo and its application. Background technique [0002] Circular RNA is a special kind of RNA molecule that widely exists in organisms. It is formed by gene transcription. The 3' end and 5' end are covalently closed, and the length is not uniform. Usually, the intron regions on both sides have reverse Complementary matching sequences. Circular RNA does not have a typical poly(A) structure, and conventional transcriptome library construction generally goes through the step of poly(A) screening, resulting in the inability to detect the existence of circular RNA, so the early non-coding RNA has been be ignored. In recent years, with the development of high-throughput sequencing technology, through non-poly(A) transcriptome sequencing, it has been found that circular RNA not ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82
CPCC12N15/8241
Inventor顾连峰王慧慧王永生高宇帮席飞虎刘旭庆王汇源张泽宇张航晓赵良真
OwnerFUJIAN AGRI & FORESTRY UNIV