Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method, primers and application for detecting SMN1 and SMN2 gene mutation

A sequencing primer, SMN-7-R technology, applied in the field of life sciences and biology, can solve the problems affecting the time of onset and disease severity of patients, and the lack of effective treatment options for SMA, so as to reduce the amount of samples and reagents used, and reduce the detection rate. The effect of low cost and detection cost

Inactive Publication Date: 2019-03-19
WUHAN ADICON CLINICAL LAB
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Generally speaking, most normal individuals have 2 copies of SMN1 gene and 2 copies of SMN2 gene. Due to the difference of C / T base at c.840 site in exon 7 of SMN2 gene, the expressed protein is large Exon 7 skipping will occur partly, and there is only a small amount of full-length SMN mRNA, that is to say, only 10% of the protein expressed by SMN2 is full-length protein, so if someone loses both copies of the SMN1 gene, it will definitely Illness, and only one copy of the SMN1 gene is a carrier. When the SMN1 gene loses its function, the SMN2 gene copy number will affect the patient's onset time and disease severity
[0005] Since there is currently no effective treatment plan for patients with SMA, the prevention and treatment of SMA mainly depends on early screening.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, primers and application for detecting SMN1 and SMN2 gene mutation
  • Method, primers and application for detecting SMN1 and SMN2 gene mutation
  • Method, primers and application for detecting SMN1 and SMN2 gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] The present invention will be further described below in conjunction with specific embodiments and accompanying drawings. It should be noted that the routine conditions and methods not described in the examples are generally used by experimenters in the field: for example, the fourth edition of the "Refined Molecular Biology Experiment Guide" edited by Osper and Kingston, Or follow the procedures and conditions recommended by the manufacturer.

[0056] A primer for detection of SMN1 and SMN2 gene c.835-44, c.840, INS7+100, INS7+215, *239 sites, the primer is designed for SMN1 and SMN2 gene c.835-44, c. Specific amplification primers designed for 840, INS7+100, INS7+215, *239 sites, including:

[0057] Primers for amplifying SMN1 and SMN2 gene c.835-44, c.840, INS7+100, INS7+215 sites, the base sequence of which is:

[0058] SMN-7-F: TGTAAAACGACGGCCAGTCAAGTGATCCCCCCTACCTCC

[0059] SMN-7-R: AACAGCTATGACCATGATTAGAACCAGAGGCTTGACGA

[0060] Primers for amplifying SMN1 a...

Embodiment 2

[0072] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0073] (1) Extract tissue DNA from blood:

[0074] 1) Take 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed.

[0075] 2) Add 20 μl proteinase K solution and mix well.

[0076] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0077] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0078] 5) Add the solution and floccu...

Embodiment 3

[0106]Take 20 clinical peripheral blood samples, extract the genome, prepare reagents and detect according to the method in Example 2. Add 2 μl of each sample to the detection system PCR reaction solution. At the same time, make positive, negative, and blank controls. The results of agarose gel electrophoresis of samples 1-20 are as follows figure 1 , figure 2 As shown, the results show that the amplification described in the present invention is effective and the bands are clear.

[0107] After sequencing, it was found that exons 7 and 8 of the SMN1 gene in sample 1 were homozygous deletions, such as image 3 , 5 , 7, 9, and 11. No homozygous deletion of the SMN1 gene occurred in the remaining samples. Taking sample 2 as an example, the sequencing results Figure 4 , 6 , 8, 10, 12 shown. In addition, based on the differences between the SMN1 gene and the SMN2 gene at these 5 sites, using the two pairs of primers of the present invention can also identify whether a ho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers for detecting homozygous deletion mutation of spinal muscular atrophy related virulence genes SMN1 and SMN2. The primers comprise primers c.835-44, c.840, INS7+100, INS7+215 and *239 sites which amplify SMN1 and SMN2. By adopting a Sanger sequencing technology, the method can be used for detecting mutation conditions of c.835-44, c.840, INS7+100, INS7+215 and *239 sites in a body of the spinal muscular atrophy patient. The detection result finished by the invention is accurate and has important reference meaning in early screening of spinal muscular atrophy.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to primers, methods and kits for detecting mutations at c.835-44, c.840, INS7+100, INS7+215 and *239 of SMN1 and SMN2 genes. Background technique [0002] Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disease characterized clinically by degeneration and degeneration of the anterior horn cells of the spinal cord, resulting in symmetrical muscle weakness and atrophy. Neuronal diseases, mainly manifested as muscle atrophy, low muscle tone, weakened tendon reflexes, and negative pathological signs, currently there is no effective treatment. SMA is usually divided into three subtypes based on disease severity and age of onset: type I patients begin at birth or before 6 months, are unable to sit or walk unaided, and usually die of respiratory insufficiency within two years; type II Patients with onset after 6 months can sit alone but cannot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q1/6883C12Q2600/156C12Q2531/113C12Q2535/101
Inventor 林筱剑吴鹏飞王淑一
Owner WUHAN ADICON CLINICAL LAB
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com