Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers, method and kit for detecting TSC2 gene locus mutation

A technology of TSC2-F and TSC2-R, which is applied in the fields of life science and biology, can solve the problems of difficulty in distinguishing pathogenic mutations, and achieve the effects of high cost, reduced cost and difficulty, and difficult detection

Inactive Publication Date: 2019-03-22
WUHAN ADICON CLINICAL LAB
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The consequences of such nonterminating changes are not easily predictable, making it difficult to distinguish pathogenic from neutral (nonpathogenic) variants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, method and kit for detecting TSC2 gene locus mutation
  • Primers, method and kit for detecting TSC2 gene locus mutation
  • Primers, method and kit for detecting TSC2 gene locus mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The present invention will be further explained below in conjunction with specific embodiments and drawings. It should be noted that the conventional conditions and methods not described in the examples usually follow the methods routinely used by experimenters in the field: for example, the fourth edition of the "Comprehensive Molecular Biology Experiment Guide" edited by Osper and Kingston, Or follow the steps and conditions recommended by the manufacturer.

[0037] A primer for detecting mutations in the TSC2 gene locus, the primer is designed for 40230C> T40239-9C> T mutation sites, including:

[0038] A method for detecting TSC2 gene 40230C> T mutation kit, including

[0039] (1) Blood DNA extraction reagent;

[0040] (2) PCR amplification reaction system reagents; including amplification of TSC2 gene 40230C> Primer of T mutation point sequence:

[0041] TSC2-F: TGTAAAACGACGGCCAGTCAACCAGGCAGTAGCCGAGAT

[0042] TSC2-R: AACAGCTATAGACCATGGCTGAGGGAGCCCCATATTC;

[0043] (3) Seque...

Embodiment 2

[0052] Operation process of blood genomic DNA extraction kit (Tiangen Bio):

[0053] (1) Extract genomic DNA from blood

[0054] 1) Draw 300μl of blood and add 900μl of red blood cell lysate, mix by inversion, and leave it at room temperature for 5 minutes, during which time, mix by inversion several times. Centrifuge at 12,000 rpm for 1 min, aspirate the supernatant, leave the white blood cell pellet, add 200 μl of buffer GA, and shake until thoroughly mixed.

[0055] 2) Add 20μl proteinase K solution and mix well.

[0056] 3) Add 200μl of buffer GB, fully invert and mix well, place at 70°C for 10 minutes, the solution should be clear, and centrifuge briefly to remove the water droplets on the inner wall of the cap.

[0057] 4) Add 200μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent precipitation may appear. Centrifuge briefly to remove the water droplets on the inner wall of the cap.

[0058] 5) Add the solution and flocculent precipitate obtained in...

Embodiment 3

[0090] Take 16 clinical samples, extract the genome, prepare reagents and test according to the methods described in Examples 1 and 2. Add 1μl of the sample to the PCR reaction solution of the detection system. The results of electrophoresis are as image 3 It is shown that the primers of the present invention can effectively amplify blood samples and have a single band.

[0091] Sample test results image 3 , Figure 4 Shown:

[0092] Figure 4 For sample TSC2 gene 40230C> Screenshot of the sequencing of the T base.

[0093] It can be seen from the detection result that the primer of the present invention has included the sequence of the mutation region, and can expand the exons 39 to 41 of the TSC2 gene and the introns between them, and the sequencing result is completely accurate. Where 40230C> There is a mutation in the base of T. The mutation site has not been reported in the known literature. The results of sequencing multiple samples show that this mutation is a new point ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers for detecting TSC2 base mutation; the primers are characterized by comprising a TSC2 gene 40230C>T mutation region; a Sanger sequencing technology can be used for rapidly detecting the mutation site. The detection completed by using the primers is accurate in results; the primers can not only assist the diagnosis of a mutation situation in a hot spot region, but canalso serve as a criterion for judging the influence of diseases related to the mutation site. The inactivated mutation of a TSC2 gene causes abnormal function of nodule protein, and affects cell differentiation and regulation functions of the nodule protein, thus leading to abnormal growth and differentiation of ectoderm, mesoderm and endoderm cells; furthermore, the mutation can be inherited. Therefore, the detection of the TSC2 gene mutation is urgent for the identification and treatment of diseases.

Description

Technical field [0001] The present invention belongs to the field of life science and biotechnology, and particularly relates to primers for detecting mutations of the TSC2 gene. Using common PCR technology, it can be used to quickly detect the mutations of the TSC2 gene. Background technique [0002] Tuberous sclerosis, also known as Bourneville disease, is an autosomal dominant neurocutaneous syndrome. There are also sporadic cases. It is usually caused by abnormal development of ectodermal tissues, including brain, skin, peripheral nerves, kidneys, etc. Multiple organ involvement, the clinical features are facial sebaceous adenoma, seizures, and loss of intelligence. The incidence rate is about 1 / 6000 live infants, and the ratio of male to female is 2:1. On May 11, 2018, the National Health Commission and other five departments jointly formulated the "First Batch of Rare Disease List", and tuberous sclerosis was Included. According to gene location, it can be divided into fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6883C12Q2600/156
Inventor 黄开新吴鹏飞王淑一
Owner WUHAN ADICON CLINICAL LAB
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More