An efficient transcriptional activation system in the Drosophila reproductive system
A technology for transcriptional activation and transcriptional activator, applied in the field of transcriptional activation systems, can solve the problems of inability to achieve large-scale construction and screening of genomes, cumbersome steps for cloning of target genes, and inability to overexpress multiple genes at the same time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] The CRISPR / Cas9 system is currently the most widely used gene editing system. Under the guidance of sgRNA, the Cas9 protein can cut specific positions in the genome. Under the guidance of sgRNA, it recognizes and binds to specific genes, but does not cut the genome. Thus, by binding dCas9 to specific DNA sequences and recruiting transcriptional activators that can activate gene expression, it can be used to study the transcription and expression of gene expression.
[0064] The present embodiment provides the method for preparing dCas9 protein, comprises the following steps:
[0065] 1. Cloning of Cas9 protein coding sequence
[0066] References Ren X, Sun J, Housden B E, et al. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(47): According to 19012-7., the Cas9 protein coding sequence was amplified by PCR using the non-cas9 vector...
Embodiment 2
[0150] For the sgRNA vector, the U6B promoter is used to control the expression of the sgRNA. The U6B promoter can be expressed in the whole body of Drosophila, including the reproductive system, and has no tissue specificity. And the expression of sgRNA is controlled by the U6B promoter, which can make the expression of sgRNA higher.
[0151]References Ren X, Sun J, Housden B E, et al. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(47): 19012-7., U6b-sgRNA-short plasmid was transformed into sgRNA vector. The specific construction method is as follows:
[0152] First, replace the sgRNA scaffold part of the U6B-sgRNA-short plasmid with the following scaffold sequence (SEQ IDNO: 34):
[0153] 5'-GTTTTAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTT-3'. ...
Embodiment 3
[0163] The construction of embodiment three flySAMG carrier
[0164] 1. Integration of dCas9 vector and sgRNA2.0 vector
[0165] The part of U6B-sgRNA2.0 expressing sgRNA and spacer was cloned by PCR. At the same time, when designing primers, restriction sites NheI and SpeI were added to the N-terminus and C-terminus respectively. The primers used were:
[0166] sgRNA2.0-F (SEQ ID NO: 38):
[0167] 5'-AAACTCATCAATGTATCTTAACTAGTGATGAAAACAAAAACAACTGTGTTGAAA AT-3'
[0168] sgRNA2.0-R (SEQ ID NO: 39):
[0169] 5'-GCACACTTATTACGTGGCCAGAGCTCTGCTAGCTTGTTCGACTTGCAGCCTGAA ATACG-3'
[0170] The partial sequence of pNP-dCas9-VP64-T2A-MCP-p65-HSF1 prepared in Example 1 was amplified as the vector backbone by PCR, and the primers used were:
[0171] flySAM2.0-F (SEQ ID NO:40): 5'-TGGCCACGTAATAAGTGTGCGTT-3'
[0172] fySAM2.0-R (SEQ ID NO:41): 5'-TGGAACCAGACATGATAAGATACATTGATGAGT-3'
[0173] Then the two PCR products were subjected to homologous recombination to obtain the integrated v...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

