Unlock instant, AI-driven research and patent intelligence for your innovation.

An efficient transcriptional activation system in the Drosophila reproductive system

A technology for transcriptional activation and transcriptional activator, applied in the field of transcriptional activation systems, can solve the problems of inability to achieve large-scale construction and screening of genomes, cumbersome steps for cloning of target genes, and inability to overexpress multiple genes at the same time.

Active Publication Date: 2021-01-01
TSINGHUA UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method can express the target gene in a specific tissue or organ, the cloning steps of the target gene are cumbersome, the cycle is long, and the expression pattern of the gene itself cannot be simulated, so false positive results often occur, and multiple genes cannot be overexpressed at the same time. Large-scale construction and screening work on a genome scale cannot be achieved
However, when the existing CRISPR / Cas9 transcriptional activation system is applied to the reproductive system, the efficiency of regulating gene expression is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An efficient transcriptional activation system in the Drosophila reproductive system
  • An efficient transcriptional activation system in the Drosophila reproductive system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] The CRISPR / Cas9 system is currently the most widely used gene editing system. Under the guidance of sgRNA, the Cas9 protein can cut specific positions in the genome. Under the guidance of sgRNA, it recognizes and binds to specific genes, but does not cut the genome. Thus, by binding dCas9 to specific DNA sequences and recruiting transcriptional activators that can activate gene expression, it can be used to study the transcription and expression of gene expression.

[0064] The present embodiment provides the method for preparing dCas9 protein, comprises the following steps:

[0065] 1. Cloning of Cas9 protein coding sequence

[0066] References Ren X, Sun J, Housden B E, et al. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(47): According to 19012-7., the Cas9 protein coding sequence was amplified by PCR using the non-cas9 vector...

Embodiment 2

[0150] For the sgRNA vector, the U6B promoter is used to control the expression of the sgRNA. The U6B promoter can be expressed in the whole body of Drosophila, including the reproductive system, and has no tissue specificity. And the expression of sgRNA is controlled by the U6B promoter, which can make the expression of sgRNA higher.

[0151]References Ren X, Sun J, Housden B E, et al. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(47): 19012-7., U6b-sgRNA-short plasmid was transformed into sgRNA vector. The specific construction method is as follows:

[0152] First, replace the sgRNA scaffold part of the U6B-sgRNA-short plasmid with the following scaffold sequence (SEQ IDNO: 34):

[0153] 5'-GTTTTAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTT-3'. ...

Embodiment 3

[0163] The construction of embodiment three flySAMG carrier

[0164] 1. Integration of dCas9 vector and sgRNA2.0 vector

[0165] The part of U6B-sgRNA2.0 expressing sgRNA and spacer was cloned by PCR. At the same time, when designing primers, restriction sites NheI and SpeI were added to the N-terminus and C-terminus respectively. The primers used were:

[0166] sgRNA2.0-F (SEQ ID NO: 38):

[0167] 5'-AAACTCATCAATGTATCTTAACTAGTGATGAAAACAAAAACAACTGTGTTGAAA AT-3'

[0168] sgRNA2.0-R (SEQ ID NO: 39):

[0169] 5'-GCACACTTATTACGTGGCCAGAGCTCTGCTAGCTTGTTCGACTTGCAGCCTGAA ATACG-3'

[0170] The partial sequence of pNP-dCas9-VP64-T2A-MCP-p65-HSF1 prepared in Example 1 was amplified as the vector backbone by PCR, and the primers used were:

[0171] flySAM2.0-F (SEQ ID NO:40): 5'-TGGCCACGTAATAAGTGTGCGTT-3'

[0172] fySAM2.0-R (SEQ ID NO:41): 5'-TGGAACCAGACATGATAAGATACATTGATGAGT-3'

[0173] Then the two PCR products were subjected to homologous recombination to obtain the integrated v...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the biotechnical field, in particular to an efficient transcriptional activation system in a reproductive system of drosophila. The transcriptional activation system comprisesdCas8 protein expression member and a sgRNA expression element. The dCas8 protein expression member contains a p-transposase promoter, a dCas9 protein coded sequence, an MCP protein coded sequence and a transcriptional activation factor coded sequence. The transcriptional activation factor coded sequence is located on the downstream side of the dCas9 protein coded sequence, and the MCP protein coded sequence is located on the downstream side of the dCas9 protein coded sequence; and the sgRNA expression element contains a U6B promoter, a sgRNA insertion site and an MCP protein recognition sequence. The transcriptional activation system provided by the invention can activate expression of a gene in the reproductive system of drosophila and is high in activation efficiency.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for efficiently regulating gene expression in organisms, and in particular to a transcriptional activation system applied in the reproductive system of Drosophila. Background technique [0002] With the successful completion of the genome project of human and other species, it is of great significance to convert the sequence information of the genome into functional information and decipher the code of life for a comprehensive understanding of human growth and development, disease and aging. As a model organism that is highly conserved with humans, Drosophila has many advantages. The research results in Drosophila are also applicable to humans, and it can get rid of the restrictions of bioethics, so it has become an ideal model organism for biomedical research. The reproductive system of Drosophila is an ideal model for research on stem cells and reproductive development in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/113C12N15/90A01K67/033
CPCA01K67/0339A01K2207/15A01K2217/072A01K2227/706A01K2267/01C12N15/113C12N15/8509C12N15/902C12N2310/10C12N2310/20
Inventor 朱丽霏倪建泉徐荣刚毛德才孙锦贾豫
Owner TSINGHUA UNIV