Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A gene silencing vector induced by cucumber green mottle mosaic virus and its construction method and application

A green mottled flower, gene silencing technology, applied in the direction of genetic engineering, biochemical equipment and methods, using vectors to introduce foreign genetic material, etc., to achieve the effect of reducing the expression level

Active Publication Date: 2021-09-07
ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the VIGS system has been successfully applied to many crops, there are still some limiting factors, such as the host range of vector application, the selection of effective target gene fragments and the stability of silencing efficiency, etc. are still issues that need to be resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene silencing vector induced by cucumber green mottle mosaic virus and its construction method and application
  • A gene silencing vector induced by cucumber green mottle mosaic virus and its construction method and application
  • A gene silencing vector induced by cucumber green mottle mosaic virus and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Construction of the VIGS vector mediated by embodiment 1.CGMMV

[0042] (1) Using the full-length invasive clone of CGMMV (PXT1-CGMMV) as a template, PCR amplification was performed with primers CP-TC-F and CP-TC-R, so that the CP start codon ATG was changed to ACG, and the PCR product It was recovered, and then transformed into E. coli competent Top10, and three positive clones were selected for sequencing verification, and the extracted plasmid with the correct sequencing result was taken and named as PXT1-CGACG. The primer sequences are as follows:

[0043] CP-TC-F:5'-CTGTTTCTTTTGAAGACGGCTTACAAT-3'

[0044] CP-TC-R: 5'-CGTCTTTCAAAAGAAACAGAACTGGACTC-3'.

[0045](2) The primers PXT1-F / 78B-99-R and PXT1-R / 78B-99-F were respectively used to amplify PXT1-CGACG and PXT1-CGMMV as templates. DNA fragment 1 containing CGMMV nt1-5840 (GenBank accession: KY753929) and DNA fragment 2 containing CGMMV nt5651-6423 were obtained respectively, see figure 1 . The primer sequence...

Embodiment 2

[0051] Example 2. Cloning and insertion of target gene fragments

[0052] (1) RNAsimple total RNA kit (Tiangen Biotech, Beijing, China) was used to extract total RNA from leaf tissues of Cucurbitaceae plants (watermelon, muskmelon, cucumber and gourd), and then Oligo dT primers, PrimeScript II reverse transcriptase ( TAKARA) to synthesize first-strand cDNA for RT-PCR by reverse transcription.

[0053] (2) A phytoene desaturase (PDS) gene forming a β-carotene synthesis pathway was selected as a target gene. Four pairs of primers were designed to amplify four PDS genes with different length fragments by referring to the known sequence information of Cucurbitaceae PDS genome in the NCBI database and combining the sequence information of the constructed vector. The primer sequences are as follows:

[0054] 78-69P-X:GAGTGGATGAGACTCTTGCACAGTTAAATTATCTTGAGCCTCCAGTTATAGGTCTAGGTC

[0055] 78-69P-S:GAGTCTCATCCACTCTTGCACAGTTAAATTATCTTGAGCCTCCATTAAGTAAAGTCCTG

[0056] 78-213-F: CCCGTC...

Embodiment 3

[0064] Example 3. Agrobacterium transformation of recombinant vector and its inoculation verification

[0065] (1) Add 5 μL of vector plasmids (CGMMV-BamHI-PDS69, CGMMV-BamHI-PDS150, CGMMV-BamHI-PDS213 and CGMMV-BamHI-PDS300) into 50 μL of GV3101 competent cells, let stand on ice for 10 min, and Quick-freeze in liquid nitrogen for 5 minutes, warm in a 37°C water bath for 5 minutes, and place on ice for 2 minutes. Place 500 μL of LB liquid medium without antibiotics in a shaker at 28°C and 200 rpm for 2 h, then centrifuge at 12,000 rpm for 1 min, collect the bacteria, and spread it on a medium containing antibiotics (50 ng / μl Kan , 50ng / μl Rif) on LB solid medium. After 48 hours, single cells were picked from the plate and cultured overnight in 200 μl LB liquid medium containing antibiotics (50ng / μl Kan, 50ng / μl Rif) to screen for positive clones.

[0066] (2) Put the screened positive clones and LB liquid medium containing antibiotics (50ng / μl Kan, 50ng / μl Rif) at a ratio of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention constructs a new VIGS vector that can be applied in cucurbit crops based on CGMMV, and provides a cucumber green mottle mosaic virus recombination vector carrying a phytoene dehydrogenase (PDS) gene fragment. Cucurbitaceae plants such as watermelon, melon, cucumber and gourd are natural hosts of CGMMV. The recombinant vector of the present invention can effectively reduce the expression level of PDS gene in Cucurbitaceae crops, so that the plants produce photobleaching phenotypes in which the PDS gene is silenced. The successful construction of the recombinant vector can be used to study gene functions, and lay the foundation for mining the genes of Cucurbitaceae plants with important agronomic traits and cultivating excellent, disease-resistant and characteristic varieties.

Description

technical field [0001] The invention specifically relates to a gene silencing vector induced by cucumber green mottle mosaic virus and its construction method and application. Background technique [0002] According to the latest statistics from FAO in 2016, the production of cucurbits such as watermelons, melons and cucumbers has increased year by year in the past decade and has played an important role in fruits and vegetables. With the improvement of agricultural production level and people's pursuit of high-quality melon vegetables, it is imperative to use the important agronomic traits genes of Cucurbitaceae crops to breed excellent, disease-resistant and characteristic varieties, and Cucurbitaceae plants such as cucumber, watermelon and melon Genome sequencing has laid the foundation for excellent gene mining and gene function research. The genetic transformation of cucurbit crops is time-consuming and labor-intensive, and the transformation efficiency is extremely lo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82
CPCC12N15/8218
Inventor 刘美古勤生
Owner ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com