Male specific DNA marker of oplegnathus punctatus and method for identifying hereditary sex

A technology of zebra sea bream and gender, which is applied in the field of male-specific DNA marker and genetic sex identification of zebra sea bream, can solve problems such as unreported, and achieve the effects of shortening time, saving detection time and cost.

Active Publication Date: 2019-04-19
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There have been no reports at home and abroad on the screening of sex-specific molecular markers and genetic sex identification of porcupine seabream

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Male specific DNA marker of oplegnathus punctatus and method for identifying hereditary sex
  • Male specific DNA marker of oplegnathus punctatus and method for identifying hereditary sex
  • Male specific DNA marker of oplegnathus punctatus and method for identifying hereditary sex

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Screening and verification of male-specific DNA fragments of porpoise

[0022] The discovery of male-specific DNA fragments: the sex chromosome-linked DNA fragment sequences used in the present invention are derived from the whole genome sequencing results of the grouper sea bream (unpublished Published), bioinformatics analysis of the genome sequence of P. chinensis screened out two homologous and different DNA fragments of X and Y chromosomes. Two homologous differential DNA fragments of X (X1 or X2) and Y chromosomes were found. The DNA fragment on the Y chromosome was 573bp long, named SEQchrY, and its sequence was SEQ ID NO: 1:

[0023] TATCTCTCTGCTCTGCCTGGGTAGCTCTGATTGTCAAGAGCATCGTAAA AACCATTAAACTGTTGTAAATAGTTTAGTCTCCTGTTTTATTCCTCAAAAGC CTTTACAGCATTTAGTGAAATTTCCTCCAGCTTTTTTAATCAGTGTTTTATTG TCTGTAAAGCCAGTTTTAGCTCTTAAGTTCTATTAGAATATATAAACAAAGT GCCTCTGCTATTTTCCACAGTATTATACTGTAGACAGATGAGCCGCTCCATA TTGGGCAGCTTTCTCAAATTGCTGTATGTTAATTTGTGTAATCAGAAAGTAG CAGGAGGT...

Embodiment 2

[0028] Example 2: Establishment and application of genetic sex identification technology for porpoise

[0029] 1. Genetic sex identification of porpoise under laboratory conditions

[0030] DNA extraction: Use the marine organisms DNA extraction kit (Tiangen) to extract the DNA of the fin ray of the grouper, use 1% agarose gel electrophoresis to identify its integrity, measure its OD value with a UV spectrophotometer, and adjust the DNA concentration to 50ng / μL, and stored at -20°C until use.

[0031] PCR identification: using the sex-specific DNA fragment primers SEQ XY: 1, SEQ XY: 2, and SEQ Y: 3 of the grouper to detect the genetic sex of the grouper by PCR. The PCR reaction system is 15 μL, including 1.5 μL of 10× buffer, 0.8 μL of dNTP, 0.3 μL of each upstream primer, 0.6 μL of downstream primer, 1 μL of template DNA (50ng / μL), 11.0 μL of ddH2O, and 0.1 μL of rTaq enzyme. PCR amplification program: 95°C for 5min; 30 cycles of 95°C for 30s, 60°C for 30s, and 72°C for 30...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a male specific DNA marker of oplegnathus punctatus, wherein the sequence of the DNA fragment on a Y chromosome is shown in SEQ ID NO: 1; the sequence of the DNA fragment on a Xchromosome is shown in SEQ ID NO: 2. The DNA fragment on the Y chromosome is 12 bp more than the fragment on the X chromosome, and the fragment is the DNA fragment peculiar to the Y chromosome. According to the invention, two homologous and different DNA fragments on the X and Y chromosomes are screened from the whole genome sequence of the oplegnathus punctatus, and a method for identifying theheredity sex of the oplegnathus punctatus is further established; and the method can be used for quickly, accurately and effectively distinguishing the heredity sex of the oplegnathus punctatus. According to the method, a specific target band amplified in a male individual cannot be amplified by a female individual, and the product can be resolved by agarose electrophoresis, so that the time for accurately identifying the heredity sex of the oplegnathus punctatus is shortened, and the method is suitable for identifying the heredity sex of the oplegnathus punctatus in a simple environment of aculture farm, and the detection time and the cost are saved. The method has important significance and application value in sex identification, seedling breeding and family selection and breeding of the oplegnathus punctatus.

Description

technical field [0001] The invention belongs to the technical field of genetic sex identification and sex control of fish in aquatic genetic breeding, and in particular relates to a male-specific DNA marker and a method for genetic sex identification of porpoise. Background technique [0002] Spotted seabream (Oplegnathus punctatus) belongs to Perciformes, Stonebreamidae, Stonebream genus, commonly known as spotted seabream, black golden drum. It is mainly distributed in the East China Sea and South China Sea, as well as the surrounding waters of Japan and Korea. It belongs to the middle and lower layer fishes near shore in the temperate zone. It often inhabits rocky reefs and corals. Its sharp teeth can crush the hard shellfish, lobsters, sea urchins, etc. The outer shell, which is often obtained by fishing, is extremely scarce in natural resources (You Hongzheng et al. 2016). The spotted grouper sea bream is tender and tender, and has a unique taste, which is deeply loved...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6879C12Q1/6888C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6879C12Q1/6888C12Q2565/125
Inventor陈松林李明徐浩田金富朱颖扶小琴翟介明马文辉
OwnerYELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI