Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A fluorescent quantitative PCR primer and kit for detecting Seneca virus type A

A fluorescence quantification and kit technology, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of the TaqMan probe fluorescence quantitative PCR detection method being meaningless, unfavorable for widespread use, and high cost. To achieve the effect of convenient laboratory and factory use, easy promotion and good accuracy

Active Publication Date: 2022-03-22
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cost of TaqMan probe fluorescent quantitative PCR detection method is too high to be widely used.
In addition, the TaqMan probe fluorescent quantitative PCR detection method is based on the presence of the target sequence during the amplification process to emit a fluorescent signal of the reporter gene, but the nucleic acid sequences of Seneca virus type A in different regions are not very consistent. If the target sequence is mutated, TaqMan probe fluorescent quantitative PCR detection method will lose its meaning

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fluorescent quantitative PCR primer and kit for detecting Seneca virus type A
  • A fluorescent quantitative PCR primer and kit for detecting Seneca virus type A
  • A fluorescent quantitative PCR primer and kit for detecting Seneca virus type A

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 detects the establishment of the fluorescent quantitative PCR method of type A Seneca virus (SVA)

[0036] 1. Primer design

[0037] The inventors of the present invention have found that the SVA L / VP4 segment gene sequence is well conserved in the SVA epidemic strains of many countries such as the United States, Brazil and China through Blast sequence comparison. Therefore, for this sequence, design A pair of primers that can be used for the detection of Seneca virus type A prevalent in various regions, the sequences of which are as follows:

[0038] Upstream primer 1: 5'TGGACTGGACATYGTATA3' (shown in SEQ ID NO.1);

[0039] Downstream primer 1: 5'TTGCGTAGTAATTGAAGGT3' (shown in SEQ ID NO.2).

[0040] Its amplified sequence is:

[0041] TGGACTGGACATYGTATACGAACTACAAGGTAATGTTCAGACAACCTCAAAGAACGATTTTGATTCCCGCGGCAATAATGGTAACATGACCTTCAATTACTACGCAA (shown in SEQ ID NO. 3). Where: Y=C / T.

[0042] After sequence comparison, it was found that by designing qPCR ...

Embodiment 2

[0078] Embodiment 2 detects the assembly of the fluorescent quantitative PCR kit of type A Seneca virus (SVA)

[0079] Main reagents in the kit:

[0080] RNA extraction reagent: TRIzol reagent;

[0081] Reverse transcription reaction solution: 5×PrimeScript RT Master Mix and DEPC water;

[0082] Fluorescent quantitative PCR reaction solution: TBGreen TM Premix Ex Taq TM (TliRNaseH Plus) and DEPC water

[0083] Upstream primer 1: 5'TGGACTGGACATCGTATA3' (shown in SEQ ID NO.1);

[0084] Downstream primer 1: 5'TTGCGTAGTAATTGAAGGT3' (shown in SEQ ID NO.2).

[0085] Standard positive DNA template: the aqueous solution of plasmid pEASY-L / VP4, the concentration is 6.4×10 10 Copy number / μL, 6.4×10 9 Copy number / μL, 6.4×10 8 Copy number / μL, 6.4×10 7 Copy number / μL, 6.4×10 6 Copy number / μL, 6.4×10 5 copy number / μL and 6.4×10 4 Copy number / μL;

[0086] Among them, 5×PrimeScript RT Master Mix, TBGreen TM Premix Ex Taq TM (TliRNaseHPlus), TRIzol were purchased from Takara C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The invention discloses a fluorescent quantitative PCR primer and kit for detecting type A Seneca virus. The primer is designed based on the gene sequence of the Seneca virus L / VP4 segment, and its upstream primer sequence is as shown in SEQ ID NO .1, the downstream primer sequence is shown in SEQ ID NO.2. The test kit of the present invention can be detected in an ordinary laboratory after adding TRIzol reagent to inactivate the virus, which is safe and convenient; it can quantitatively detect the A-type Seneca virus, and the minimum detection limit concentration is 6.4×10° copies / μL, high sensitivity; no amplification reaction to type A foot-and-mouth disease virus cDNA, type O foot-and-mouth disease virus cDNA, swine fever virus cDNA, good specificity, can be used to detect type A Seneca virus-infected animal samples such as blood, tissue The virus can also be used for the basic research of Seneca virus type A, the development of vaccines, the detection of virus titers in the production process, etc., and has a good application prospect.

Description

technical field [0001] The invention relates to a fluorescent quantitative PCR primer and a kit for detecting type A Seneca virus. The invention belongs to the technical field of veterinary biological diagnosis. Background technique [0002] Senecavirus A (SVA) has caused blistering disease in many countries and regions in recent years. As a new pathogenic factor, it is similar to foot-and-mouth disease and can cause great economic losses. After 2015, Outbreaks in the United States, Brazil and China have caused considerable economic damage, but diagnostics and commercialized vaccines have been slow to be developed or researched. Since it was introduced into China, it was distributed in 2015-2016. Since 2017, SVA has spread rapidly in Fujian, Guangdong, Guangxi, Henan (11 counties), Hebei, Shandong, Liaoning and other provinces, causing a large number of pig farms to become sick . [0003] SVA is the only member of the Picornaviridae family that belongs to the genus Seneca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/701C12Q2600/166C12Q2531/113C12Q2563/107C12Q2545/113C12Q2521/107
Inventor 郭慧琛穆素雨孙世琪张韵茹嘉喜郭笑然罗建勋殷宏
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com