Epothilone biosynthetic gene transcriptional regulation protein and preparation method thereof

A technology of epothilone and gene transcription, which is applied in the field of genetic engineering and can solve the problems of high price and low yield of epothilone

Inactive Publication Date: 2019-04-26
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, epothilone B and epothilone D have also been used in clinical trials, but due to the low yield and high price of epothilone, their wide application is limited.
The production of epothilones can be effectively increased through the overexpression of epothilones transcriptional regulatory proteins of Sonocystis cellulosus Soce90 and So 0157-2. At present, there are few reports on the transcriptional regulatory proteins of epothilone biosynthetic genes in S. cellulosus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Epothilone biosynthetic gene transcriptional regulation protein and preparation method thereof
  • Epothilone biosynthetic gene transcriptional regulation protein and preparation method thereof
  • Epothilone biosynthetic gene transcriptional regulation protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: Cloning and analysis of promoter P3:

[0020] 1. Cloning of the promoter sequence

[0021] two,

[0022] 1. Design primers:

[0023] P3 upstream primer: 5'-TGGCGTCGGGCGCGGGG-3'

[0024] P3 downstream primer: 5'-TTGGGGATTGGAGAC-3'

[0025] 2. Extract the genomes of three bacterial strains of S. cellulosus So ce M1, So ce M4 and So ce M6 with the bacterial genome extraction kit, according to the above p3 primer (comprising the P3 upstream primer and the P3 downstream primer) PCR, with Epothilium The P3 and P5 fragments ( figure 1 ), but the non-epothilone-producing S. cellulosus So ce M1 and So ceM6 could not amplify any fragments, indicating that the P3 and P5 fragments are specific fragments of epothilones producing bacteria.

[0026] The PCR reaction system is as follows:

[0027]

[0028] The PCR amplification procedure is as follows:

[0029]

[0030]

[0031] After recovery, the obtained PCR products were connected to pMD18-T vector, co...

Embodiment 2

[0032] Example 2: P3 promoter functional verification

[0033] The P3 promoter was amplified by PCR, and XhoI and HindIII restriction sites were introduced at the 5' end and 3' end, respectively, recovered by cutting the gel, digested with XhoI and HindIII at 37°C for 4 hours, and recovered the product, and simultaneously used XhoI and HindIII37 Digest pGL3-Basic at ℃ for 2 hours, and recover the large fragment. Ligate the digested P3 promoter sequence and pGL3-Basic vector at 22°C for 3.0 h, transform into Escherichia coli DH5α, pick clones for expansion and culture, use P3 upstream primers and P3 downstream primers to carry out bacterial liquid PCR amplification respectively, and the obtained Positive clones were sequenced and verified, thus obtaining the PGL3-P3 recombinant vector (double enzyme digestion verification such as figure 2 shown), which is to insert the P3 promoter into the pGL3-Basic vector. The promoter pgpd was also inserted into the pGL3-Basic vector as d...

Embodiment 3

[0035]Embodiment 3: the acquisition of Sorangium cellulosum (Sorangium cellulosum) So ce M4 epothilone biosynthesis gene transcriptional regulatory protein, comprises the steps:

[0036] The 50 bp core sequence (TGCGATCTTGTGATTCCCCTTCTGATCTTTAAAATTTCCCGATCCCCCAT) of the promoter P3 of the epothilone biosynthesis gene cluster was labeled with the EMSA probe biotin labeling kit, and the specific steps were as follows:

[0037] Synthesize the P3 promoter core sequence and its complementary sequence, dilute to 1 μM with water, and configure the following system:

[0038]

[0039]

[0040] After mixing, incubate at 37°C for 30min, then mix equal volumes of sense strand and antisense strand, add annealing buffer (10×), mix well, and then perform annealing reaction under the following conditions: 95°C for 2 minutes, then 90 minutes Decrease 0.1°C every 8 seconds, and the resulting probe is used for EMSA detection.

[0041] The biotin-labeled P3 promoter was added to the strept...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses epothilone biosynthetic gene transcriptional regulation protein and a preparation method thereof. According to the epothilone biosynthetic gene transcriptional regulation protein and the preparation method thereof, a biotin-labeled epothilone biosynthetic gene promoter P3 fishing method is adopted for the first time to obtain the transcriptional regulation protein of an SOce M4 epothilone biosynthetic gene cluster, and the function of the transcriptional regulation protein is verified by adopting an EMSA experiment. The obtained novel epothilone biosynthetic gene cluster transcriptional regulation protein can lay a molecular biological foundation for the biosynthetic transcriptional regulation of sprangium cellulosum epothilone and the heterologous expression of the epothilone biosynthetic gene cluster, and therefore the efficient biosynthesis of the epothilone and the wide application of the epothilone in the aspect of biological medicine are promoted.

Description

Technical field: [0001] The invention belongs to the field of genetic engineering, and in particular relates to an epothilone biosynthesis gene transcription regulation protein and a preparation method thereof. Background technique: [0002] S. cellulosus is a myxobacteria with rich secondary metabolites. Epothilone is a class of 16-membered macrolide compounds with broad-spectrum and high anti-tumor activity produced by S. cellulosus. Due to its better water solubility, lower side effects, broader antitumor activity and good antitumor activity against drug-resistant tumor cells, epothilone has become the most promising compound to replace paclitaxel. At present, ixabepilone, a derivative of epothilone, has been approved for clinical treatment of advanced breast cancer, and achieved good curative effect. Moreover, epothilone B and epothilone D have also been used in clinical trials, but due to the low yield and high price of epothilones, their wide application is limited. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/195C07K1/22
CPCC07K14/195
Inventor叶伟章卫民刘桃妹李浩华李赛妮黄自磊朱牧孜许丽琼
OwnerGUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY