Supercharge Your Innovation With Domain-Expert AI Agents!

Promoter increasing expression level of foreign proteins of pichia pastoris and application of promoter

An exogenous protein, Pichia pastoris technology, applied in the field of genetic engineering, can solve problems such as unsatisfactory protein expression, and achieve the effects of promoting wide application, reducing production costs, and increasing expression.

Active Publication Date: 2019-05-10
QINGDAO VLAND BIOTECH GRP
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, many foreign genes have been successfully expressed in Pichia pastoris, but the expression level of many proteins is not ideal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, the design of new promoter ATX, the construction of cloning and expression plasmid

[0034] 1. Design and cloning of the new promoter ATX

[0035] Based on the gene sequence of the alcohol oxidase promoter AOX1 of Pichia pastoris, the applicant removed the TATAbox sequence in the gene sequence, and the modified new promoter sequence was SEQ ID NO: 1, named ATX. The new promoter ATX was synthesized from the whole gene by Huada Gene Company.

[0036] Clone the new promoter ATX by PCR reaction, primers and reaction conditions are as follows:

[0037] Primer 1 (F): ATC AGATCT AACATCCAAAGACGAAAGGTTGAA

[0038] Primer 1 (R): CGTTT GGATCC TTCGAATAATTAGTTGTTTTTTG

[0039] The PCR conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 seconds, renaturation at 56°C for 30 seconds, extension at 72°C for 1 minute, and after 35 cycles, incubation at 72°C for 10 minutes. The full length of the new promoter ATX gene is 941bp.

[00...

Embodiment 2

[0045] Embodiment 2 Construction of the Pichia pastoris engineering strain expressing phytase recombinantly

[0046] 1. Phytase gene connection expression vector pATX9K

[0047] Escherichia coli phytase APPA (its nucleotide sequence is SEQ ID NO: 3, encoded amino acid sequence is SEQ ID NO: 4), with restriction endonuclease Eco R I and not I carry out double enzyme digestion, 50 μl enzyme digestion system is as follows: Phytase APPA 43μl, 10×FastDigest Buffer 5 μl, Eco R I 1 μl, not I 1 μl. After enzyme digestion at 37°C for 2 hours, it was recovered by agarose gel electrophoresis.

[0048] The new vector pATX9K was treated with restriction endonuclease Eco R I and not I performed double enzyme digestion, and the 50 μl enzyme digestion system was as follows: 43 μl of the new vector pATX9K, 5 μl of 10×FastDigest Buffer, Eco R I 1 μl, not I 1 μl. After enzyme digestion at 37°C for 2 hours, it was recovered by agarose gel electrophoresis.

[0049] will pass ...

Embodiment 3

[0066] Example 3 Construction of Pichia pastoris engineering strains expressing mannanase recombinantly

[0067] In order to further verify that the promoter ATX provided by the present invention also has a significant promoting effect on the expression of other foreign proteins, the applicant refers to the method described in Example 2 and uses the new promoter ATX to construct recombinantly expressed mannanase MAN (its nucleus The nucleotide sequence is SEQ ID NO: 5, the coding amino acid sequence is SEQ ID NO: 6) engineering strain of Pichia pastoris, and the engineering strain of Pichia pastoris recombinantly expressing mannanase MAN constructed by using the promoter AOX1 is used as control group.

[0068] Pick the above-mentioned engineering strains and inoculate them into BMGY medium, shake and culture at 30°C, 220rpm for 24 hours, then transfer to BMMY medium, shake at 30°C, 220rpm, add 0.5% methanol every 24 hours. After 4 days of induced expression, the cells were re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel promoter. The promoter can significantly increase the expression level of foreign proteins of pichia pastoris. The promoter can increase the expression level of enzyme genes such as hemicellulase, peroxidase and protease in the pichia pastoris by 76-320%, and the effect is remarkable, thereby facilitating the great reduction of the production cost of the enzymes andpromoting the wide application of the enzymes.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a promoter for improving the protein expression of Pichia pastoris and its application. Background technique [0002] The Pichia pastoris expression system is a new type of exogenous protein expression system developed in the early 1980s. Compared with the E. coli expression system, the Pichia pastoris expression system has obvious advantages, such as: shorter doubling time , the fermentation cycle is short; the genome is simple and easy to operate; the culture conditions are relatively simple, and it is easy to carry out high-density culture, and then can obtain a higher yield of the target protein; foreign proteins can be folded, glycosylated, and disulfide bonded, etc. ; At the same time, it also avoids defects such as poor secretion efficiency of Saccharomyces cerevisiae, unstable expression strains, and easy loss of expression plasmids; The length is 8-14 mannos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/81C12N9/16C12N9/24C12R1/84
Inventor 程斯达康丽华李宾黄亦钧
Owner QINGDAO VLAND BIOTECH GRP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More