A method for identifying microbial gene functions based on inducible promoters
A gene function and promoter technology, applied in the field of genetic engineering, can solve the problems of inability to perform two kinds of analysis at the same time, no experimental proof of universality, and long homologous ends of primers, so as to reduce transformation verification work and apply to a wide range of genes , high repeatability and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0164] Example 1: ZMO1360 mutant strain was constructed by replacing the ZMO1360 promoter.
[0165] (1) The promoter selects the intergenic sequence in front of the gene
[0166] 5’-AAAAAGTCTTTTCGCTTCGGCAGAAGAGGTTCATCATGAACAAAAATTCGGCATTTTTAAAAATGCCTATAGCTAAATCCGGAACGACACTTTAGAGGTTTCTGGGTCATCCTGATTCAGACATAGTGTTTTGAATATATGGAGTAAGCA-3’, in the Operon and Gene Finding in Bacteria functional area on the Softberry website ( http: / / www.softberry.com / berry.phtml? topic=bprom&group=programs&subgroup= gfindb ) to obtain the potential promoter sequence (the set promoter region has been marked above)
[0167] Promoter Pos: 120LDF-2.10
[0168] -10box at pos.105GGTCATCCT Score 36
[0169] -35box at pos.84ACGACA Score -1
[0170] (2) Specifically design 4 specific primers for the promoter of the target gene (genome 43518bp-43549bp),
[0171] Specific primers used to amplify the upstream and downstream homology arms, including:
[0172] Upstream front primer: 5'- AGGGATTTTGGTCATG...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap