LM3 liver cancer cell line with stable CPG (carboxypeptidase) gene knockout and construction method thereof
A construction method and cell line technology, applied in the fields of biomedicine and gene editing research, can solve the problems of lack of relevant literature and achieve high transfection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1. Using optimized CRISPR / Cas9 technology to construct a vector for knocking out the CPQ gene
[0060] (1) With the Lentivirus V2 vector (Zhang Feng Lab, MIT) as the basic skeleton, the genome sequence of the human CPQ gene was downloaded from NCBI and the structure was analyzed to find the transcription start region, and a pair was selected based on the online design of this region sgRNA, its upstream and downstream sgRNA sequences are as follows:
[0061] sgRNA1 CTTATCTTCGCATTTTTCGG(TGG)
[0062] sgRNA2 CAGAAGTGCCAATCGCTCAT(AGG)
[0063] Among them, the three bases in brackets are the PAM domain (NGG)
[0064] The sequences of four primers were designed as follows:
[0065] KOCPQ primer I (sgRNA1 sequence is underlined)
[0066] 5′-CGTCTCGCACCG CTTATCTTCGCATTTTTTCGG GTTTTAGAGCTAGAAATAG-3′
[0067] KOCPQ primer II
[0068] 5′-CAAAAAAGCACCGACTCGGTGCCACTTTTTTC-3′
[0069] The first PCR uses primers primer I and primer II to obtain a PCR product of 115bp ...
Embodiment 2
[0090] Embodiment 2, knock out the establishment of CPQ stable cell line, the specific implementation steps are as follows:
[0091] (1) After the recombinant plasmid was extracted and the concentration of the plasmid was determined by NanoDrop1000, the integrity of the plasmid was detected by electrophoresis.
[0092] (2) 24-48 hours before cell transfection, seed the cells in a 100mm culture dish at a density of 1-10×10 5 HEK293T cells per milliliter were used for transfection when the cell confluency reached 50-70% the next day.
[0093] (3) Cell transfection experiment. Using the method of packaging lentivirus for transfection, the positive recombinant plasmid obtained in Example 1 was mixed with the viral packaging plasmid pVSVG and PSPA×2 in a mass ratio of 10:1:9 (total mass 8 μg), and added to 500 μl Opti- Add 32μl transfection reagent to the MEM basic medium, mix well, and let stand at room temperature for 30min; at the same time, remove the medium in the culture sy...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


