Unlock instant, AI-driven research and patent intelligence for your innovation.

LM3 liver cancer cell line with stable CPG (carboxypeptidase) gene knockout and construction method thereof

A construction method and cell line technology, applied in the fields of biomedicine and gene editing research, can solve the problems of lack of relevant literature and achieve high transfection efficiency

Inactive Publication Date: 2019-06-21
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the research on the function of CPQ mainly focuses on the basic research on tumor proliferation and migration, and the relevant literature is relatively scarce.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LM3 liver cancer cell line with stable CPG (carboxypeptidase) gene knockout and construction method thereof
  • LM3 liver cancer cell line with stable CPG (carboxypeptidase) gene knockout and construction method thereof
  • LM3 liver cancer cell line with stable CPG (carboxypeptidase) gene knockout and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1. Using optimized CRISPR / Cas9 technology to construct a vector for knocking out the CPQ gene

[0060] (1) With the Lentivirus V2 vector (Zhang Feng Lab, MIT) as the basic skeleton, the genome sequence of the human CPQ gene was downloaded from NCBI and the structure was analyzed to find the transcription start region, and a pair was selected based on the online design of this region sgRNA, its upstream and downstream sgRNA sequences are as follows:

[0061] sgRNA1 CTTATCTTCGCATTTTTCGG(TGG)

[0062] sgRNA2 CAGAAGTGCCAATCGCTCAT(AGG)

[0063] Among them, the three bases in brackets are the PAM domain (NGG)

[0064] The sequences of four primers were designed as follows:

[0065] KOCPQ primer I (sgRNA1 sequence is underlined)

[0066] 5′-CGTCTCGCACCG CTTATCTTCGCATTTTTTCGG GTTTTAGAGCTAGAAATAG-3′

[0067] KOCPQ primer II

[0068] 5′-CAAAAAAGCACCGACTCGGTGCCACTTTTTTC-3′

[0069] The first PCR uses primers primer I and primer II to obtain a PCR product of 115bp ...

Embodiment 2

[0090] Embodiment 2, knock out the establishment of CPQ stable cell line, the specific implementation steps are as follows:

[0091] (1) After the recombinant plasmid was extracted and the concentration of the plasmid was determined by NanoDrop1000, the integrity of the plasmid was detected by electrophoresis.

[0092] (2) 24-48 hours before cell transfection, seed the cells in a 100mm culture dish at a density of 1-10×10 5 HEK293T cells per milliliter were used for transfection when the cell confluency reached 50-70% the next day.

[0093] (3) Cell transfection experiment. Using the method of packaging lentivirus for transfection, the positive recombinant plasmid obtained in Example 1 was mixed with the viral packaging plasmid pVSVG and PSPA×2 in a mass ratio of 10:1:9 (total mass 8 μg), and added to 500 μl Opti- Add 32μl transfection reagent to the MEM basic medium, mix well, and let stand at room temperature for 30min; at the same time, remove the medium in the culture sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biomedicine and gene editing researches, in particular to a construction method of an LM3 cell line with CPG (carboxypeptidase) gene knockout. The LM3 cell line with stable CPQ knockout is constructed through an improved CRISPR / Cas 9 (clustered regularly interspaced short palindromic repeats / Cas 9) related techniques. recombinant plasmids for CPQ knockout is constructed through sgRNA design, synthesis of insert fragments and enzyme cleavage; after lentivirus is packaged, culture medium supernate containing viruses is collected; the supernate which is filtered is added to pre-cultured LM3 cells for incubation; Puromycin resistance screening and subculture are performed on the virus-transfected LM3 cells so that the stable LM3 liver cancer cell line withpositive CPQ knockout. The establishment of the cell line herein helps provide a new experimental material for studying molecular mechanism of CPQ in the Oncogenesis and development and regulating changes in tumor metabolism, and also helps provide references for related modeling of liver cancer.

Description

technical field [0001] The invention relates to the fields of biomedicine and gene editing research, in particular, the invention relates to a stable LM3 cell line knocked out of the CPQ gene and a construction method thereof. Background technique [0002] The tumor susceptibility gene CPQ (PGCP) encodes a very important human plasma glutamic acid carboxypeptidase, and is also an important exocrine protein in plasma, with a theoretical molecular weight of 51.88kDa. One of the important members. Existing literature research and statistical analysis of the TCGA database have shown that the copy number of CPQ protein is significantly increased and overexpressed in a variety of malignant tumors (including liver cancer, ovarian cancer, breast cancer, lung cancer, thyroid tumor, etc.), while in human The expression levels in normal tissues and patients' paracancerous tissues were relatively low. In the clinic, regulating the activity of CPQ may also become an important way to tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/90C12N5/10
Inventor 朴海龙李同明
Owner DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI