Genetically engineered bacterium for expressing high-activity ice nucleation protein and construction method of genetically engineered bacterium

A technology of genetically engineered bacteria and ice nucleoprotein, applied in the field of genetically engineered bacteria expressing highly active ice nucleoprotein and its construction, can solve the problems of complex genetic background and limit the maximum utilization of ice nucleoprotein, and achieve clear genetic background, Improve the activity and efficiency of ice nucleoprotein

Active Publication Date: 2019-07-12
GUANGDONG OCEAN UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The utilization of ice nucleation protein is mainly achieved by adjusting the fermentation conditions such as temperature and pH value to promote the expression of ice nucleation protein in ice nucleation bacteria, or by extracting and purifying ice nucleation protein, but Erwinia herbicola (Erwinia herbicola), clove pseudomonas The genetic background of ice-nucleating bacteria such as Pseudomonas syringae and Pantoea ananas is complex, and there is a certain degree of difficulty in genetic modification, so the modification of engineering bacteria limits the improvement of ice-nucleating activity and the improvement of ice-nucleating protein. maximum utilization of
Purification of ice nucleation protein can ensure its safety, but studies have shown that ice nucleation protein needs to be combined with lipids in the cell membrane to function to the greatest extent, so carrier bacteria are required to achieve ice nucleation protein activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for expressing high-activity ice nucleation protein and construction method of genetically engineered bacterium
  • Genetically engineered bacterium for expressing high-activity ice nucleation protein and construction method of genetically engineered bacterium
  • Genetically engineered bacterium for expressing high-activity ice nucleation protein and construction method of genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The selection and optimization of the starting bacterial strain of embodiment 1

[0026] Although Escherichia coli is an conditional pathogen, its inactivated strain is not pathogenic, and the inactivated strain can also ensure the activity of ice nucleoprotein, and the genetic background of Escherichia coli is clear, and the genetic modification is highly safe and operable. And efficient, so Escherichia coli was selected as the starting strain of the ice nucleoprotein engineering bacteria.

[0027] Wild-type Escherichia coli MG1655, DH5α and BW25113 can all be used as starting strains.

[0028] The inventors have found that the activity of the ice nucleation protein of the ice nucleation protein strain is related to the degree of fatty acid saturation and the average chain length of the bacterial strain. , in one of the most preferred schemes, compare the chain length and degree of saturation of three strains of wild-type Escherichia coli MG1655, DH5α, and BW25113, an...

Embodiment 2

[0038] Example 2 Construction of MG1655-△fadR-△fabF Double Knockout Mutant

[0039] In order to obtain fatty acids with shorter chain length and higher degree of saturation, two genes in MG1655, β-ketoacyl-ACP synthase Ⅰ gene (FabF) and fatty acid degradation inhibitor gene (FadR), were knocked out, in which β- The nucleotide sequence of the ketoacyl-ACP synthetase I gene (FabF) is SEQ ID NO.1, and the nucleotide sequence of the fatty acid degradation inhibitor gene (FadR) is SEQ ID NO.2.

[0040] SEQ ID NO.1

[0041] ATGTTGTCTCCTGTCGGCAATACCGTAGAGTCTACCTGGAAAGCTCTGCTTGCCGGTCAGAGTGGCATCAGCCTAATCGACCATTTCGATACTAGCGCCTATGCAACGAAATTTGCTGGCTTAGTAAAGGATTTTAACTGTGAGGACATTATCTCGCGCAAAGAACAGCGCAAGATGGATGCCTTCATTCAATATGGAATTGTCGCTGGCGTTCAGGCCATGCAGGATTCTGGCCTTGAAATAACGGAAGAGAACGCAACCCGCATTGGTGCCGCAATTGGCTCCGGGATTGGCGGCCTCGGACTGATCGAAGAAAACCACACATCTCTGATGAACGGTGGTCCACGTAAGATCAGCCCATTCTTCGTTCCGTCAACGATTGTGAACATGGTGGCAGGTCATCTGACTATCATGTATGGCCTGCGTGGCCCGAGCATCTCTATCGCGACTGCCTGTACTTCCGGCGT...

Embodiment 3

[0067] Example 3 Transfer of thioesterase gene into MG1655-△fadR-△fabF double knockout mutant

[0068] Using the genome of Arabidopsis thaliana as a template to clone the thioesterase gene AtFat, its nucleotide sequence is shown in SEQ ID NO:3:

[0069] ATGTGACTGATTCTAAGTTACAGAGAAGCTTACTCTTCTTCTCCCATTCATATCGATCTGATCCGGTGAATTTCATCCGTCGGAGAATTGTCTCTTGTTCTCAGACGAAGAAGACAGGTTTGGTTCCTTTGCGTGCTGTTGTATCTGCTGATCAAGGAAGTGTGGTTCAAGGTTTGGCTACTCTCGCGGATCAGCTCCGATTAGGTAGTTTGACTGAAGATGGTTTATCTTATAAAGAGAAGTTTGTTGTTAGATCTTACGAAGTGGGTAGTAACAAAACCGCTACTGTTGAAACCATTGCTAATCTTTTACAGGAGGTGGGATGTAATCATGCACAAAGTGTTGGTTTTTCGACTGATGGGTTTGCAACAACAACTACTATGAGGAAGTTGCATCTCATTTGGGTTACTGCGAGAATGCATATCGAGATCTATAAGTACCCTGCTTGGGGTGATGTGGTTGAGATAGAGACTTGGTGTCAGAGTGAAGGAAGGATTGGGACAAGGCGTGATTGGATTCTTAAGGATTCTGTCACTGGTGAAGTCACTGGCCGTGCTACAAGCAAGTGGGTGATGATGAACCAAGACACGAGACGGCTTCAGAAAGTTTCTGATGATGTTCGGGACGAGTACTTGGTCTTCTGTCCTCAAGAACCGAGGTTAGCATTTCCGGAAGAGAATAACAGAAGCTTGAAGAAAATCCCGAAACTCGAAGATCCGGCTCAGTATTCAATGATTGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, in particular to a construction method of a genetically engineered bacterium for expressing a high-activity ice nucleation protein (INP). Escherichia coli is taken as an original strain, a beta-ketoacyl ACP synthetase I gene (FabF) and fatty acid degradation inhibiting factor gene (FadR) of the escherichia coli are subjected to knockout at the same time, after knockout, the beta-ketoacyl ACP synthetase I gene (FabF) and the fatty acid degradation inhibiting factor gene (FadR) are transferred into a thioesterase gene (Fat) expression carrier and an ice nucleation protein gene expression carrier, and the genetically engineered bacterium for expressing the high-activity ice nucleation protein is obtained. The invention further provides the genetically engineered bacterium, constructed by adopting the method, for expressing the high-activity ice nucleation protein. The construction method is simple and easy to implement, and the obtained genetically engineered bacterium can express the high-activity ice nucleation protein.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a genetically engineered bacterium expressing highly active ice nuclei protein and a construction method thereof. Background technique [0002] Water in nature does not freeze at 0°C, but is in a supercritical state, and cannot freeze until -15°C to -2°C; pure water needs to freeze at -40°C. Ice nucleation protein (INP) is a kind of special protein that can make water form ice crystals at relatively high temperature (-5℃~-2℃). Carriers, ice-nucleating bacteria mainly include Erwinia herbicola, Pseudomonas syringae, and Pantoea ananas, etc., which are useful in artificial rainfall and snowfall, food freezing and preservation, and high-sensitivity detection. Great application prospects, such as: In terms of insecticide, improving the overwintering mortality of agricultural pests is a feasible way to effectively control insect pests, constructing genetically engineered bacteria t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/70C12N15/66C12N1/21C12R1/19
CPCC07K14/195C12N15/70Y02P20/54
Inventor于非非朱坤吴金贤曲炳良余祥勇刘永
OwnerGUANGDONG OCEAN UNIVERSITY