Unlock instant, AI-driven research and patent intelligence for your innovation.

Cold-tolerant correlative coding gene of oryza rufipogon in bud stage, and applications thereof

An encoding gene and wild rice technology, which is applied to a cold tolerance-related encoding gene in the budding stage of common wild rice and its application field, can solve the problems of rice seed germination obstruction, seed death, growth point stop growing, etc.

Pending Publication Date: 2019-08-06
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Rice suffers from cold damage during the budding stage, which will hinder the germination of rice seeds, stop the growth of growth points, and long-term low temperature will lead to the death of seeds. The temperature during sowing in high latitude and high altitude areas restricts the promotion of many varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cold-tolerant correlative coding gene of oryza rufipogon in bud stage, and applications thereof
  • Cold-tolerant correlative coding gene of oryza rufipogon in bud stage, and applications thereof
  • Cold-tolerant correlative coding gene of oryza rufipogon in bud stage, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Construction of Overexpression Vector of Common Wild Oryza sativa Cold Tolerance Related Gene WRCT-1 Gene

[0061] 1. Acquisition of WRCT-1 gene

[0062] Using the DNA of common wild rice Y12-4 (Oryzarufipogon Griff.) as a template, use the following primers primer1 and primer2 to perform PCR amplification to obtain the target gene:

[0063] primer1: 5'CGGGGTACCATGACGACAAAAGACCTTT 3';

[0064] primer2: 5' CTTAATTAATCAGCTGCGAACTCCATT 3'. After recovering and purifying the PCR product, it was connected to Zero (purchased from Beijing Quanshijin Company) sequencing vector, transformed into DH5α competent cells, and the positive clones were selected for sequencing.

[0065] Sequencing results show that the amplified PCR product sequence is the nucleotide sequence shown in SEQ ID No.1, the length is 1419bp, named WRCT-1 gene, and the amino acid sequence of the protein encoded by the WRCT-1 gene is shown in SEQ ID No. .2 shown.

[0066] 2. Construction of an overexpressio...

Embodiment 2

[0071] Cultivation of overexpressed WRCT-1 transgenic plants and identification of transgenic plants with increased expression level of cold tolerance-related gene WRCT-1 gene in common wild rice

[0072] 1. Cultivation of overexpressed WRCT-1 transgenic plants with increased expression levels of the cold tolerance-related gene WRCT-1 gene in common wild rice The recombinant vector PMDC32-WRCT-1 was transformed into indica and japonica rice through Agrobacterium tumefaciens EHA105, specifically Methods as below:

[0073] 1. Import the recombinant vector PMDC32-WRCT-1 obtained in Example 1 into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector PMDC32-WRCT-1; The recombinant Agrobacterium tumefaciens EHA105 of 1 was cultured at 28°C for 16 hours, and the bacterial cells were collected; the bacterial cells were diluted with N6 liquid medium (Sigma, catalog number C1416) containing 100 μM ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cold-tolerant correlative coding gene of oryza rufipogon in a bud stage. The name of the cold-tolerant correlative coding gene is WRCT-1. Applications of the cold-tolerant correlative coding gene WRCT-1 in the regulation of the germination rate of paddy rice under low temperature, or the applications in the cultivation of cold-tolerant transgenic paddy rice in the bud stage are also disclosed. The cold-tolerant correlative coding gene WRCT-1 is identified for the first time; the cold-tolerant correlative coding gene WRCT-1 has cold-tolerant characteristics in the budstage under conditions of enhanced function or increased expression; and the important effects of cold-tolerant correlative coding gene protein or the protein thereof on controlling the cold toleranceof the paddy rice in the bud stage can be proved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a common wild rice germination stage cold tolerance-related coding gene and its application. Background technique [0002] Rice is one of the most important food crops for human beings, accounting for about 50% of the world's population whose staple food is rice. The demand for rice in Asia is increasing year by year. Due to rapid economic development, increasing population pressure, sharp increase in industrial land, and decrease in arable land, rice production is facing tremendous pressure. Therefore, continuously improving and tapping the high-yield potential of rice is the main research direction of scientists. There is a close relationship between cold tolerance in rice germination stage and quality and yield. [0003] Low temperature is an important limiting factor affecting rice yield. Rice is sensitive to low temperature during the germination stage. Japonic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8273Y02A40/146
Inventor 潘英华梁云涛徐志健陈达庆
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI