Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant bacterium for producing L-histidine, construction method of recombinant bacterium and method of producing L-histidine

A construction method and technology of recombinant bacteria, applied in the field of microbial fermentation, can solve the problems of rare transformation and optimization, and achieve the effects of easy process and cost control, improved histidine synthesis capacity, and short fermentation period

Active Publication Date: 2019-08-13
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the modification and optimization of precursor ADP synthesis, a key limiting factor for ATP synthesis, has been rarely reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacterium for producing L-histidine, construction method of recombinant bacterium and method of producing L-histidine
  • Recombinant bacterium for producing L-histidine, construction method of recombinant bacterium and method of producing L-histidine
  • Recombinant bacterium for producing L-histidine, construction method of recombinant bacterium and method of producing L-histidine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 The promoter and RBS optimization of the gene purA encoding adenosuccinate synthase

[0055] To enhance the expression of purA gene encoding adenosuccinate synthase, the promoter of purA gene was replaced with a strong promoter and its RBS was optimized.

[0056] According to the purA gene of Corynebacterium glutamicum ATCC13032 in Genbank and its upstream and downstream sequences and P tuf The primers were designed separately for the promoter sequence. An optimized RBS sequence (TTATCGGTATAGGGAAAGATTAGGAAGGAGGTTATTAC) was added before the start codon ATG. Using the ATCC13032 genome as a template, using P1 and P2 as primers for PCR amplification, the PCR product of 225bp was obtained as carrying P tuf The DNA fragment (SEQ ID NO: 1) of promoter and optimized RBS sequence, wherein, from the 1st-187th position of 5' end is P tuf Promoter sequence, the 188th-225th position is the optimized RBS sequence; PCR amplification is carried out with P3 and P4 as primer...

Embodiment 2

[0075] Example 2 Knockout of 5'-nucleotidase encoding gene ushA

[0076] First, primers were designed according to the ushA gene of Corynebacterium glutamicum ATCC13032 in Genbank and its upstream and downstream sequences. Using Corynebacterium glutamicum ATCC13032 genomic DNA as a template, using P14 and P15 as primers to PCR amplify the upstream homology arm of ushA gene (640bp, SEQ ID NO.4); using P16 and P17 as primers to amplify the downstream homology of ushA gene Arm (655bp, SEQ ID NO.5). Using the Gibson assembly method, the purified PCR product was ligated with the homologous recombination vector pK18mobsacB (purchased from the American Type Microorganism Collection ATCC, Cat. No. 87097) that had been digested with Xba I and Sma I. The ligation product was transformed into Escherichia coli EC135 by chemical transformation method, and the transformants were screened on the LB plate containing kanamycin (50 μg / mL). After subcultured for three generations, the transform...

Embodiment 3

[0086] Example 3 Increase in the copy number of the gene purA encoding adenosuccinate synthase

[0087] In order to enhance the expression of the gene purA encoding adenosuccinate synthase, the method of increasing the copy number of the purA gene on the chromosome is adopted. Additional copies of the purA gene are inserted at targeted chromosomal locations including the P tuf Promoter and expression cassettes of the optimized RBS and purA gene coding regions described in Example 1.

[0088] First, a homologous recombination plasmid that increases the copy number of the purA gene on the chromosome is constructed.

[0089] According to the upstream and downstream sequences of the target insertion site of Corynebacterium glutamicum ATCC13032, the P of strain CG327 tuf Design primers for -purA sequence. Using the genomic DNA of bacterial strain CG327 as a template, using P20 and P21 as primers to amplify the upstream homology arm (1000bp, SEQ ID NO.6) of the target insertion s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant bacterium for producing L-histidine, a construction method of the recombinant bacterium and a method of producing the L-histidine. Compared with an original strain, the recombinant bacterium for producing the L-histidine has the improved expression and / or activity of adenosine succinic acid synthetase PurA, and the original strain is a strain capable of accumulating the L-histidine. According to the recombinant bacterium and the construction method of the recombinant bacterium, based on the pioneering principle, by enhancing AMP synthesis in the synthesispath of nucleotide and improving the synthesis capacity of a bacterial strain ATP, enough precursor substances and energy carriers ATP are provided for efficient histidine synthesis, and the histidine synthesis capacity of the recombinant bacterium strain is significantly improved.

Description

technical field [0001] The present invention generally relates to the field of microbial fermentation, and specifically relates to a recombinant bacterium producing L-histidine, a construction method thereof and a production method of L-histidine. Background technique [0002] L-histidine is the ninth essential amino acid for humans and animals. It participates in important physiological processes such as body growth and development, anti-oxidation, and immune regulation. It is an important medicinal amino acid and can be used for the treatment of heart disease, anemia, and gastrointestinal ulcers. infusion preparations. At present, the production of L-histidine mainly adopts the protein hydrolysis extraction method using pig (cattle) blood meal as raw material. The production cost of L-histidine is high and expensive. The production of L-histidine by microbial fermentation is still in the stage of laboratory research and has not been applied in large-scale industrializati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/77C12N15/74C12P13/24C12R1/15C12R1/01
CPCC12N9/93C12N15/74C12N15/77C12P13/24C12Y603/04004
Inventor 温廷益商秀玲张芸刘树文
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More