Recombinant bacterium for producing L-histidine, construction method of recombinant bacterium and method of producing L-histidine
A construction method and technology of recombinant bacteria, applied in the field of microbial fermentation, can solve the problems of rare transformation and optimization, and achieve the effects of easy process and cost control, improved histidine synthesis capacity, and short fermentation period
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1 The promoter and RBS optimization of the gene purA encoding adenosuccinate synthase
[0055] To enhance the expression of purA gene encoding adenosuccinate synthase, the promoter of purA gene was replaced with a strong promoter and its RBS was optimized.
[0056] According to the purA gene of Corynebacterium glutamicum ATCC13032 in Genbank and its upstream and downstream sequences and P tuf The primers were designed separately for the promoter sequence. An optimized RBS sequence (TTATCGGTATAGGGAAAGATTAGGAAGGAGGTTATTAC) was added before the start codon ATG. Using the ATCC13032 genome as a template, using P1 and P2 as primers for PCR amplification, the PCR product of 225bp was obtained as carrying P tuf The DNA fragment (SEQ ID NO: 1) of promoter and optimized RBS sequence, wherein, from the 1st-187th position of 5' end is P tuf Promoter sequence, the 188th-225th position is the optimized RBS sequence; PCR amplification is carried out with P3 and P4 as primer...
Embodiment 2
[0075] Example 2 Knockout of 5'-nucleotidase encoding gene ushA
[0076] First, primers were designed according to the ushA gene of Corynebacterium glutamicum ATCC13032 in Genbank and its upstream and downstream sequences. Using Corynebacterium glutamicum ATCC13032 genomic DNA as a template, using P14 and P15 as primers to PCR amplify the upstream homology arm of ushA gene (640bp, SEQ ID NO.4); using P16 and P17 as primers to amplify the downstream homology of ushA gene Arm (655bp, SEQ ID NO.5). Using the Gibson assembly method, the purified PCR product was ligated with the homologous recombination vector pK18mobsacB (purchased from the American Type Microorganism Collection ATCC, Cat. No. 87097) that had been digested with Xba I and Sma I. The ligation product was transformed into Escherichia coli EC135 by chemical transformation method, and the transformants were screened on the LB plate containing kanamycin (50 μg / mL). After subcultured for three generations, the transform...
Embodiment 3
[0086] Example 3 Increase in the copy number of the gene purA encoding adenosuccinate synthase
[0087] In order to enhance the expression of the gene purA encoding adenosuccinate synthase, the method of increasing the copy number of the purA gene on the chromosome is adopted. Additional copies of the purA gene are inserted at targeted chromosomal locations including the P tuf Promoter and expression cassettes of the optimized RBS and purA gene coding regions described in Example 1.
[0088] First, a homologous recombination plasmid that increases the copy number of the purA gene on the chromosome is constructed.
[0089] According to the upstream and downstream sequences of the target insertion site of Corynebacterium glutamicum ATCC13032, the P of strain CG327 tuf Design primers for -purA sequence. Using the genomic DNA of bacterial strain CG327 as a template, using P20 and P21 as primers to amplify the upstream homology arm (1000bp, SEQ ID NO.6) of the target insertion s...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com