Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transformant specific detection primer for transgenic insect-resistant and herbicide-resistant corn CM8101 and application thereof in backcrossing

A technology for herbicide tolerance and detection of primers, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve unrealistic problems

Pending Publication Date: 2019-09-24
CHONGQING ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, with the acceleration of the migration of rural labor to cities, the scale and mechanization of corn planting has become a trend, which makes the traditional manual weeding method unrealistic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transformant specific detection primer for transgenic insect-resistant and herbicide-resistant corn CM8101 and application thereof in backcrossing
  • Transformant specific detection primer for transgenic insect-resistant and herbicide-resistant corn CM8101 and application thereof in backcrossing
  • Transformant specific detection primer for transgenic insect-resistant and herbicide-resistant corn CM8101 and application thereof in backcrossing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Integration of the target gene in the genome of insect-resistant and herbicide-resistant transgenic maize CM8101

[0024] 1. Southern blot hybridization detection technology

[0025] (1) Agarose electrophoresis: Take a certain amount of DNA sample to be tested, and digest 10-20 μg with an appropriate restriction endonuclease; after digestion, perform electrophoresis on agarose gel; after electrophoresis, transfer to membrane.

[0026] (2) Blot transfer: cut the gel and mark it (excision in the lower left corner) for easy positioning, then place the gel in a container, depurinate it with 0.25M HCl for 10 min; soak the gel in an appropriate amount of denaturing solution, Place it at room temperature for 30 minutes to denature it, and shake gently without interruption; cut the filter paper and nylon membrane to the same size as the glue, and immerse the nylon membrane in the transfer buffer for 30 minutes to balance; spread layer by layer, leaving no air bubbles ...

Embodiment 2

[0042] Example 2 Analysis of exogenous insertion sequence

[0043] The flanking genome sequence of the inserted fragment and the sequence inserted into the maize genome near the 5' end and 3' end were obtained by optimized Tail-PCR method.

[0044] According to the hiTAIL-PCR method reported by Liu Yaoguang et al., the specific primers for hiTAIL-PCR were designed according to the sequence of the 5' end and 3' end of the vector. The nucleotide sequence and the length of the amplified fragment are shown in Table 3. See Table 4 for arbitrary degenerate primers AD1-n (n is 1 to 4), AC-1 and AD6 used in hiTAIL-PCR.

[0045] Table 3 specific primers

[0046] serial number name Primer sequence (5'-3') SEQ ID No.1 LB0-1 AGGGGTGTGGAAATAGTGATTTGAGCACGTC SEQ ID No.2 LB1-1 ACGATGGACTCCAGTCCAACGTCGTGACTGGGAAAACCCTGGC SEQ ID No.3 LB2-1 TTGCAGCATCACCCCCTTTCGCCAGCT SEQ ID No.4 RB0-1 CTCAGGATTTAGCAGCATTCCGGGTAC SEQ ID No.5 RB1-2 GTAA...

Embodiment 3

[0065] Example 3 Backcross Transgenic Population Cry1Ab-Ma Gene-specific Qualitative PCR Detection

[0066] During the backcross breeding process, the CM8101 transformant-specific qualitative PCR was used to detect the primer 8101-5'F / R, and the prospects of the Cry1Ab-Ma gene were detected on the plants screened by glufosinate-ammonium and Bt test strips. The Cry1Ab-Ma gene was carried in the single plant used for backcrossing. The molecular marker 8101-5'F / R could amplify a 629bp fragment in the three generations (BC3, BC4, BC5) and CM8101 (T9) of nine backcross populations ( Figure 7 ), proving that the Cry1Ab-Ma gene in CM8101 was successfully transferred to 9 recipient inbred lines by backcrossing, and it was stably inherited in each backcrossing generation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of transgenic plant detection, and particularly relates to a transformant specific detection primer for transgenic insect-resistant and herbicide-resistant corn CM8101 and application thereof in backcrossing. A PCR method of the primer can serve as an effective means for identifying CM8101 transformants and is applied to backcrossing of CM8101 transformant insect-resistant genes. The method has the advantages of rapidity, high sensitivity, good specificity and low experimental condition requirement, thereby having very high practical value. The method provides a supervision means for further application of CM8101.

Description

technical field [0001] The invention belongs to the field of transgenic plant detection, and in particular relates to a specific detection primer for a transgenic insect-resistant and herbicide-resistant maize CM8101 transformant and its application in backcross breeding. Background technique [0002] Corn is an important grain, feed and industrial raw material crop, and plays an important role in national food security and national economic development. In recent years, my country's corn planting area has remained at more than 500 million mu, mainly distributed in more than 20 provinces, municipalities and autonomous regions across the country. Due to changes in farming system and natural climate, the Asian corn borer has seriously affected the yield, total yield and quality of corn, and has become an important pest in corn production in my country. Field weeds compete with crops for water, fertilizer, light energy and growth space, directly affecting crop yield and qualit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13
Inventor 杨小艳谢树章翁建峰雷开荣王忠伟韩垚吴红
Owner CHONGQING ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com