Unlock instant, AI-driven research and patent intelligence for your innovation.

Calycanthus praecox gene CpAP1, protein for encoding gene and application

A technology of wintersweet and protein, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as the absence of AP1 research reports, unclear function and mechanism of action, etc.

Active Publication Date: 2019-10-11
SOUTHWEST UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] In recent years, with the continuous update and enrichment of research techniques and research methods, the research on the AP1 gene has become more systematic, and the flowering regulatory network centered on the AP1 gene has gradually been enriched. Did not appear, and its function and mechanism of action are not clear, and further research is needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Calycanthus praecox gene CpAP1, protein for encoding gene and application
  • Calycanthus praecox gene CpAP1, protein for encoding gene and application
  • Calycanthus praecox gene CpAP1, protein for encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Cloning of Example 1 Wintersweet CpAP1 Gene

[0052] Sequence analysis of the CpAP1 gene obtained from the transcriptome was carried out to design specific primers, and the first strand of C. cDNA was used as a template to amplify the CpAP1 gene. The PCR reaction system and reaction conditions were as follows:

[0053] CpAP1-F(5'-3'): ACGAAGATGGGGAGGGGTAG

[0054] CpAP1-R (5'-3'): CCAGGAAAAGCACTAGGATG

[0055] PCR amplification system:

[0056]

[0057] PCR reaction program:

[0058] Denaturation at 94°C for 5min; denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 1min, 26 cycles; extension at 72°C for 10min.

[0059] The results of PCR amplification of the open reading frame of Wintersweet CpAP1 gene were detected by electrophoresis, and the results showed that the target band was specific (such as figure 1 ). The PCR product was cloned into the pMD19-T vector, transformed into Escherichia coli, detected with CpAP1-F (10 μM) and CpAP1-...

Embodiment 2

[0065] Example 2 Analysis of the expression characteristics of Wintersweet CpAP1 gene

[0066] The wintersweet material used in this experiment is Chimonanthus praecox. The total RNA of the stems, leaves, axillary buds and fruits of the extracted wintersweet, as well as the axillary buds and flowers of adult flowering plants at different stages.

[0067] The Actin and Tublin genes of Wintersweet were selected as the dual internal reference genes for real-time fluorescence quantification of the CpAP1 gene of Wintersweet. Primer Premier 5.0 software was used to design specific primers for the internal reference gene and the target gene CpAP1, and then sent to Beijing Liuhe Huada Gene Technology Co., Ltd. Co., Ltd., and the primer sequences are listed in Table 1.

[0068] Table 1 Real-time fluorescent quantitative PCR primers

[0069] Primer name Primer sequence qCpAP1-F GGGAACTAACTCTCTGTGGGC qCpAP1-R CTCTCTGAGACTCAAGGCGTC qCpActin-F GTTATGGTTGG...

Embodiment 3

[0080] Example 3 Genetic Transformation and Functional Analysis of Wintersweet CpAP1 Gene in Arabidopsis

[0081] Combining the restriction enzyme cutting sites and distribution characteristics contained in the CpAP1 gene ORF frame sequence itself and the characteristics of the multiple cloning sites contained in the plant overexpression vector pCAMBIA2301g used, the restriction enzyme cutting sites BamHI and EcoRI and the upstream and downstream of the original specific primers were added. Its corresponding protective bases are used to amplify the CpAP1 gene coding region carrying suitable restriction sites and clone it into the plant expression vector. The primer names and sequences are as follows:

[0082] p-CpAP1-F( CG ACGAAGATGGGGAGGGGTAG, the underlined part is the protected base, and the boxed part is the BamHI restriction site);

[0083] p-CpAP1-R( CG CCAGGAAAAGCACTAGGATG, the underlined part is the protected base, and the boxed part is the EcoRI restriction s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant molecular biology, in particular to a calycanthus praecox gen CpAP1, a protein for encoding the gene and application. The calycanthus praecox blossoming keygene CpAP1 is obtained through cloning, a 534bp open reading frame is obtained, and 177 amino acids are encoded. It is found that after gene transformation is conducted on wild type arabidopsis thaliana, three strains of transgenic arabidopsis thaliana have the rosette leaf number obviously smaller than that of the wild type (WT) compared with the wild type arabidopsis thaliana; meanwhile, the sprouting time, first-flower blossoming time and first-pod forming time of a transgenic plant are obviously earlier than those of the wild type. It is found that after transformation is conducted on anarabidopsis thaliana mutant ap1, the phenotype of the mutant ap1 is restored. It is shown that the gene has a function of promoting plant blossoming and has the functions of typical A-type genes in flower developing models ABCDE, and the development of plant calyx and petals is adjusted.

Description

technical field [0001] The invention belongs to the field of plant molecular biology, and specifically relates to a wintersweet CpAP1 gene, its coded protein and application. Background technique [0002] Cesaceae is a relict plant of the Tertiary Period, with a very ancient origin and a long history of evolution. Chimonanthus praecox is a deciduous shrub of the genus Chimonanthus Lindl. in the family Calycanthaceae, with a plant height of 3 to 4 meters. The leaves are opposite and semi-leathery; the flowers are born in the leaf axils, and the outermost perianth is brown and scale-like, and turns yellow inward; it blooms in winter and is resistant to cold, drought, and shearing. The flowering period is from December to February of the following year. Aoxue stands tall, Linghan is in full bloom, together with Baimei, camellia, and narcissus, they are called "Four Friends in the Snow". In Li Shizhen's "Compendium of Materia Medica", it is recorded that "Winter plum, which i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/74C12N1/21C12N15/82A01H5/00A01H6/20
CPCC07K14/415C12N15/74C12N15/8205C12N15/827
Inventor 李志能李玲眭顺照李名扬李先源
Owner SOUTHWEST UNIV