Calycanthus praecox gene CpAP1, protein for encoding gene and application
A technology of wintersweet and protein, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as the absence of AP1 research reports, unclear function and mechanism of action, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Cloning of Example 1 Wintersweet CpAP1 Gene
[0052] Sequence analysis of the CpAP1 gene obtained from the transcriptome was carried out to design specific primers, and the first strand of C. cDNA was used as a template to amplify the CpAP1 gene. The PCR reaction system and reaction conditions were as follows:
[0053] CpAP1-F(5'-3'): ACGAAGATGGGGAGGGGTAG
[0054] CpAP1-R (5'-3'): CCAGGAAAAGCACTAGGATG
[0055] PCR amplification system:
[0056]
[0057] PCR reaction program:
[0058] Denaturation at 94°C for 5min; denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 1min, 26 cycles; extension at 72°C for 10min.
[0059] The results of PCR amplification of the open reading frame of Wintersweet CpAP1 gene were detected by electrophoresis, and the results showed that the target band was specific (such as figure 1 ). The PCR product was cloned into the pMD19-T vector, transformed into Escherichia coli, detected with CpAP1-F (10 μM) and CpAP1-...
Embodiment 2
[0065] Example 2 Analysis of the expression characteristics of Wintersweet CpAP1 gene
[0066] The wintersweet material used in this experiment is Chimonanthus praecox. The total RNA of the stems, leaves, axillary buds and fruits of the extracted wintersweet, as well as the axillary buds and flowers of adult flowering plants at different stages.
[0067] The Actin and Tublin genes of Wintersweet were selected as the dual internal reference genes for real-time fluorescence quantification of the CpAP1 gene of Wintersweet. Primer Premier 5.0 software was used to design specific primers for the internal reference gene and the target gene CpAP1, and then sent to Beijing Liuhe Huada Gene Technology Co., Ltd. Co., Ltd., and the primer sequences are listed in Table 1.
[0068] Table 1 Real-time fluorescent quantitative PCR primers
[0069] Primer name Primer sequence qCpAP1-F GGGAACTAACTCTCTGTGGGC qCpAP1-R CTCTCTGAGACTCAAGGCGTC qCpActin-F GTTATGGTTGG...
Embodiment 3
[0080] Example 3 Genetic Transformation and Functional Analysis of Wintersweet CpAP1 Gene in Arabidopsis
[0081] Combining the restriction enzyme cutting sites and distribution characteristics contained in the CpAP1 gene ORF frame sequence itself and the characteristics of the multiple cloning sites contained in the plant overexpression vector pCAMBIA2301g used, the restriction enzyme cutting sites BamHI and EcoRI and the upstream and downstream of the original specific primers were added. Its corresponding protective bases are used to amplify the CpAP1 gene coding region carrying suitable restriction sites and clone it into the plant expression vector. The primer names and sequences are as follows:
[0082] p-CpAP1-F( CG ACGAAGATGGGGAGGGGTAG, the underlined part is the protected base, and the boxed part is the BamHI restriction site);
[0083] p-CpAP1-R( CG CCAGGAAAAGCACTAGGATG, the underlined part is the protected base, and the boxed part is the EcoRI restriction s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



