Supercharge Your Innovation With Domain-Expert AI Agents!

Populus deltoides brown leaf rust-resistant gene PdGsSRK, expressed protein, cloning primer pair and application thereof

A disease-resistant gene, leaf rust technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased wood yield and weakened photosynthesis ability.

Active Publication Date: 2019-11-12
NANJING FORESTRY UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The occurrence of leaf rust will cause the poplar to shed leaves early, and the photosynthetic ability will be weakened, resulting in a significant decline in wood production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Populus deltoides brown leaf rust-resistant gene PdGsSRK, expressed protein, cloning primer pair and application thereof
  • Populus deltoides brown leaf rust-resistant gene PdGsSRK, expressed protein, cloning primer pair and application thereof
  • Populus deltoides brown leaf rust-resistant gene PdGsSRK, expressed protein, cloning primer pair and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: The PdGsSRK gene of PdGsSRK resistant to leaf rust in Populus americana was screened by analyzing the sequence analysis of the target interval of the disease resistance locus combined with the dynamic expression analysis of the transcriptome

[0027] 1. Obtain the anti-rust target interval sequence of the American black poplar genome

[0028] Combined with the SSR primer sequences in the poplar genetic map, 7 SSR primer sequences were used to bridge the resistance target interval in the genetic map and the poplar genome sequence information (Table 1). Taking the assembled three-generation genome of Populus americana as the reference genome, the BLASTN algorithm was used to anchor the target intervals of the quantity resistance and quality resistance of poplar leaf rust resistance to the physical position of the genome, and the sequence of the target interval of the genome was obtained. Further use Pfam, SMART database and MEME algorithm to annotate the R gene...

Embodiment 2

[0040] Example 2: Verification of resistant and susceptible PdGsSRK gene resistance responses of PdGsSRK gene inoculated with resistant and susceptible Populus americana

[0041] qRT-PCR was used to detect the expression pattern of the disease-resistant gene PdGsSRK in the resistant and susceptible poplar genotypes. Referring to the experimental design scheme of transcriptome sequencing, two contrasting poplar rust-resistant clones "T20" and susceptible clone "NL895" were selected. The genotypes were treated with rust inoculation, and the mRNA extracted from the leaf samples of the resistant and susceptible genotype poplars at 0h, 24h, 48h, 72h, 96h, 120h, 144h, and 168h after leaf rust inoculation were reverse transcribed into cDNA qRT-PCR analysis was performed.

[0042] Use the Primer Premier 5.0 program to design gene-specific primers, two pairs of primers for the sequences at both ends of the PdGsSRK gene:

[0043] Forward primer: AAACCTTGTCGCCTACCCCTAC21;

[0044] Reve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PdGsSRK gene for resistance to Populus deltoides brown leaf rust, and discloses an expression protein, a cloning primer pair and an application thereof. The gene is a serine / threonine kinase (STK) R gene and plays an important role in the resistance to leaf rust. Based on the analysis of Populus deltoides brown leaf rust-resistant gene loci, combined with dynamic gene expression analysis, the PdGsSRK gene is determined to be a key gene regulating Populus deltoides brown leaf rust resistance. The PdGsSRK gene provides an important genetic resource for breeding the newPopulus deltoides varieties resistant to brown leaf rust.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a disease-resistant gene PdGsSRK, an expressed protein, a pair of cloning primers and an application thereof. Background technique [0002] American black poplar is a fast-growing poplar that was introduced and cultivated in my country in the 1970s and widely promoted in southern my country. Since the 1990s, poplar rust began to occur in the American black poplar plantations in my country, and the incidence became more and more serious. It has become the main disease that seriously affects the yield of the American black poplar plantations. The researchers observed the morphological characteristics of the poplar leaf rust collected from the American black poplar plantation, combined with the molecular marker fingerprint analysis, and determined that the rust fungus that endangered the American black poplar plantation in my country was P. larix poplar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/82C07K14/415C12Q1/6809
CPCC07K14/415C12N15/8282C12Q1/6809C12Q2535/122C12Q2537/165C12Q2539/103
Inventor 韦素云吴怀通李小平陈赢男尹佟明
Owner NANJING FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More