Populus deltoides brown leaf rust-resistant gene PdGsSRK, expressed protein, cloning primer pair and application thereof
A disease-resistant gene, leaf rust technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased wood yield and weakened photosynthesis ability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: The PdGsSRK gene of PdGsSRK resistant to leaf rust in Populus americana was screened by analyzing the sequence analysis of the target interval of the disease resistance locus combined with the dynamic expression analysis of the transcriptome
[0027] 1. Obtain the anti-rust target interval sequence of the American black poplar genome
[0028] Combined with the SSR primer sequences in the poplar genetic map, 7 SSR primer sequences were used to bridge the resistance target interval in the genetic map and the poplar genome sequence information (Table 1). Taking the assembled three-generation genome of Populus americana as the reference genome, the BLASTN algorithm was used to anchor the target intervals of the quantity resistance and quality resistance of poplar leaf rust resistance to the physical position of the genome, and the sequence of the target interval of the genome was obtained. Further use Pfam, SMART database and MEME algorithm to annotate the R gene...
Embodiment 2
[0040] Example 2: Verification of resistant and susceptible PdGsSRK gene resistance responses of PdGsSRK gene inoculated with resistant and susceptible Populus americana
[0041] qRT-PCR was used to detect the expression pattern of the disease-resistant gene PdGsSRK in the resistant and susceptible poplar genotypes. Referring to the experimental design scheme of transcriptome sequencing, two contrasting poplar rust-resistant clones "T20" and susceptible clone "NL895" were selected. The genotypes were treated with rust inoculation, and the mRNA extracted from the leaf samples of the resistant and susceptible genotype poplars at 0h, 24h, 48h, 72h, 96h, 120h, 144h, and 168h after leaf rust inoculation were reverse transcribed into cDNA qRT-PCR analysis was performed.
[0042] Use the Primer Premier 5.0 program to design gene-specific primers, two pairs of primers for the sequences at both ends of the PdGsSRK gene:
[0043] Forward primer: AAACCTTGTCGCCTACCCCTAC21;
[0044] Reve...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com