Heat stress protein HSP70 gene of Schizothorax wangchiachii, detection method and application of detection method
A technology of heat stress protein and Schizothorax, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as hindering the detection of stress ability of Schizothorax and unknown sequence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 target gene cloning
[0033] Step 1: Extract RNA
[0034] 1) Schizothorax was anesthetized with MS-222 and dissected, and the hepatopancreas tissue was quickly separated and placed in a cryopreservation tube, which was quickly frozen in liquid nitrogen and then transferred to -80°C for future use. About 80 mg of liver tissue was taken out from the liquid nitrogen, placed in a pre-cooled mortar, and the tissue was ground into powder before the liquid nitrogen was volatilized, and 1 mL of Trizol was added quickly. After homogenization, the Trizol / tissue mixture was left at room temperature for 5 minutes to allow the sample to be fully lysed by Trizol.
[0035] 2) Add 200 μL of chloroform or trichloromethane to every 1 mL of Trizol lysed sample.
[0036] 3) Close the cap tightly and shake vigorously up and down for 15 seconds.
[0037] 4) Place at room temperature for 3 minutes.
[0038] 5) Centrifuge at 12000 g for 15 min at 4°C.
[0039] 6) After centri...
Embodiment 2
[0106] The expression level of embodiment 2 HSP70 gene in Schizothorax liver, kidney, spleen tissue
[0107] Step 1: Extract the total RNA in the liver, kidney, and spleen tissue, reverse transcribe it into cDNA, and the method is the same as that in Example 1.
[0108] Step 2: According to the full-length sequence of the Schizothorax Hsp70 gene, use Primer 5.0 software to design fluorescent real-time quantitative PCR-specific primers. The primer sequences are as follows:
[0109] HSP70F': CATGAACCCCCACCAACACAG, see SEQ ID NO.15;
[0110] HSP70R': TCACCCTTGTAATCAACCTGGA, see SEQ ID NO.16.
[0111] Schizothorax internal reference gene sequence:
[0112] ACTIN-F:CCTGTTCCAGCCATCCTTCT, see SEQ ID NO.17;
[0113]ACTIN-R: CAGCAATGCCAGGGTACATG, see SEQ ID NO. 18.
[0114] Step 3: Using CFX Connect TM Fluorescent quantitative PCR instrument and Power For RT-PCR using the Green PCR Master Mix kit, refer to the kit instructions.
[0115] PCR reaction system: The total reaction s...
Embodiment 3
[0118] Example 3 Periodic starvation-feeding research on the influence of HSP70 gene expression in the liver, kidney, and spleen of young Schizothorax brevista. Experimental design: The present invention designs a control group, three starvation treatment groups, and each handles three Repeated, the experimental period was 8 weeks. The starvation treatment and feeding time are as follows:
[0119] S0: the control group, fed with full food every day during the experiment, which lasted for 8 weeks;
[0120] S1: Starve for 1 day on the first day of each week, feed for 6 days with full food, repeat for 8 weeks;
[0121] S2: The first and second days of each week were starved for 2 consecutive days, fed for 5 days, and repeated for 8 weeks;
[0122] S3: On the first, second, and third day of each week, the animals were starved for 3 consecutive days, fed for 4 days, and repeated for 8 weeks.
[0123] After the experiment, the expression levels of HSP70 in the liver, kidney, and ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



