Heat stress protein HSP70 gene of Schizothorax wangchiachii, detection method and application of detection method

A technology of heat stress protein and Schizothorax, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as hindering the detection of stress ability of Schizothorax and unknown sequence

Active Publication Date: 2019-11-29
WATER ENG ECOLOGICAL INST CHINESE ACAD OF SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, at present, there is no relevant report on the heat stress protein HSP70 gene of Schizothorax brevistoralis, and its sequence is also unknown, which hinders the development of research on the detection of stress ability of Schizothorax brevistoralis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heat stress protein HSP70 gene of Schizothorax wangchiachii, detection method and application of detection method
  • Heat stress protein HSP70 gene of Schizothorax wangchiachii, detection method and application of detection method
  • Heat stress protein HSP70 gene of Schizothorax wangchiachii, detection method and application of detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 target gene cloning

[0033] Step 1: Extract RNA

[0034] 1) Schizothorax was anesthetized with MS-222 and dissected, and the hepatopancreas tissue was quickly separated and placed in a cryopreservation tube, which was quickly frozen in liquid nitrogen and then transferred to -80°C for future use. About 80 mg of liver tissue was taken out from the liquid nitrogen, placed in a pre-cooled mortar, and the tissue was ground into powder before the liquid nitrogen was volatilized, and 1 mL of Trizol was added quickly. After homogenization, the Trizol / tissue mixture was left at room temperature for 5 minutes to allow the sample to be fully lysed by Trizol.

[0035] 2) Add 200 μL of chloroform or trichloromethane to every 1 mL of Trizol lysed sample.

[0036] 3) Close the cap tightly and shake vigorously up and down for 15 seconds.

[0037] 4) Place at room temperature for 3 minutes.

[0038] 5) Centrifuge at 12000 g for 15 min at 4°C.

[0039] 6) After centri...

Embodiment 2

[0106] The expression level of embodiment 2 HSP70 gene in Schizothorax liver, kidney, spleen tissue

[0107] Step 1: Extract the total RNA in the liver, kidney, and spleen tissue, reverse transcribe it into cDNA, and the method is the same as that in Example 1.

[0108] Step 2: According to the full-length sequence of the Schizothorax Hsp70 gene, use Primer 5.0 software to design fluorescent real-time quantitative PCR-specific primers. The primer sequences are as follows:

[0109] HSP70F': CATGAACCCCCACCAACACAG, see SEQ ID NO.15;

[0110] HSP70R': TCACCCTTGTAATCAACCTGGA, see SEQ ID NO.16.

[0111] Schizothorax internal reference gene sequence:

[0112] ACTIN-F:CCTGTTCCAGCCATCCTTCT, see SEQ ID NO.17;

[0113]ACTIN-R: CAGCAATGCCAGGGTACATG, see SEQ ID NO. 18.

[0114] Step 3: Using CFX Connect TM Fluorescent quantitative PCR instrument and Power For RT-PCR using the Green PCR Master Mix kit, refer to the kit instructions.

[0115] PCR reaction system: The total reaction s...

Embodiment 3

[0118] Example 3 Periodic starvation-feeding research on the influence of HSP70 gene expression in the liver, kidney, and spleen of young Schizothorax brevista. Experimental design: The present invention designs a control group, three starvation treatment groups, and each handles three Repeated, the experimental period was 8 weeks. The starvation treatment and feeding time are as follows:

[0119] S0: the control group, fed with full food every day during the experiment, which lasted for 8 weeks;

[0120] S1: Starve for 1 day on the first day of each week, feed for 6 days with full food, repeat for 8 weeks;

[0121] S2: The first and second days of each week were starved for 2 consecutive days, fed for 5 days, and repeated for 8 weeks;

[0122] S3: On the first, second, and third day of each week, the animals were starved for 3 consecutive days, fed for 4 days, and repeated for 8 weeks.

[0123] After the experiment, the expression levels of HSP70 in the liver, kidney, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for detecting the tissue expression quantity of a heat stress protein HSP70 gene of Schizothorax wangchiachii. The method comprises the following steps of: firstly, extracting total RNA from the liver of Schizothorax wangchiachii, performing reverse transcription to obtain a cDNA first strand, cloning HSP70 gene 5'-and 3'-sequences by adopting a RACE amplificationmethod, and splicing partial sequences, and 5'-and 3'-sequences of HSP70 cDNA obtained by cloning by utilizing software. The obtained complete sequence contains 2348 bases, and the open reading frame(ORF) contains 1950 bases and encodes 649 amino acids. The expression quantity of Hsp70 in liver, kidney and spleen tissues is detected by fluorescence real-time quantitative PCR. The research of periodic starvation-feeding on HSP70 gene expression in liver, kidney and spleen of juvenile Schizothorax wangchiachii indicates that kidney can be used as the target organ for starvation stress. The method lays a foundation for researching the Hsp70 expression regulation mechanism of the Schizothorax wangchiachii.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a heat-stress protein HSP70 gene of Schizothorax brevista, a detection method and an application thereof. Background technique [0002] As molecular chaperones, heat stress proteins are evolutionarily highly conserved and functionally important proteins, which widely exist in the entire biological kingdom from lower prokaryotes to higher mammals. HSP70 is one of the important members of the HSPs family. It is expressed at a low level under normal conditions, and can be induced to up-regulate under stress conditions (temperature, osmotic pressure, inflammation, microbial infection, heavy metals, starvation and hypoxia, etc.) Expression, it participates in protein synthesis, folding, assembly and transportation as a molecular chaperone, and can repair and degrade partially denatured or damaged proteins, thereby enhancing the body's ability to resist stress. HSP70 i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/46C12Q1/6888C12Q1/6851
CPCC07K14/461C12Q1/6851C12Q1/6888C12Q2600/124C12Q2600/156C12Q2531/113C12Q2563/107C12Q2561/113
Inventor 王崇梁银铨
Owner WATER ENG ECOLOGICAL INST CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap