Unlock instant, AI-driven research and patent intelligence for your innovation.

ADH (ethanol dehydrogenase) protein family mutant and application thereof

A technology of mutant protein and carrier, applied in the biological field, can solve problems such as interference of target protein purity

Active Publication Date: 2019-12-10
KANGMA SHANGHAI BIOTECH LTD
View PDF4 Cites 32 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, in practical application, this purification method also has certain problems
Taking Ni-NTA resin as an example, some non-target proteins also have several discontinuous histidine residues on the surface of their three-dimensional structure, which causes the protein to bind to Ni-NTA resin to a certain extent, so that the purity of the final target protein disturbed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ADH (ethanol dehydrogenase) protein family mutant and application thereof
  • ADH (ethanol dehydrogenase) protein family mutant and application thereof
  • ADH (ethanol dehydrogenase) protein family mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1K

[0260] Example 1 K. lactis middle ADH Analysis and specific modification of family genes

[0261] 1.1 K. lactis middle ADH Analysis of family genes

[0262] When Ni medium is used for K. lactis When the target protein containing the His tag expressed in the affinity purification, there is an obvious non-specific band at 35-50kDa. The results of mass spectrometry showed that the non-specific protein was mainly derived from K. lactis ADH family proteins in (Table 1). ADH is a NAD(P)-dependent oxidoreductase present in almost all organisms that catalyzes the reversible oxidation of primary and secondary alcohols to aldehydes and ketones, respectively. K. lactis ADH family proteins in include Kl ADH1, Kl ADH2, Kl ADH3, Kl There are four types of ADH4, all encoded by chromosomal DNA. Wherein, ADH1 gene sequence (SEQ ID NO.164), KEGG database coding is Kl LA0F21010g, located on F chromosome; ADH2 gene sequence (SEQ ID NO.29), KEGG database code is Kl LA0F18260g, lo...

Embodiment 2

[0273] Example 2 Targeted knockout by CRISPR / Cas9 ADH1 Gene

[0274] 2.1 Kl ADH1 CRISPR gRNA sequence determination

[0275] According to Kl ADH1 designed point mutation, select PAM sequence (NGG), and determine the corresponding gRNA sequence. The principle of gRNA selection in this example is: moderate GC content (40%-60%), and avoid the existence of poly T structure. In this example, KlADH1 The gRNA1 sequence is TGGGTGAAAACGTCAAGGGC (SEQ ID NO.: 45).

[0276] Plasmid construction and transformation methods are as follows: use primer pKMCas9- Kl ADH1-gRNA1-PF: TGGGTGAAAACGTCAAGGGCGTTTTAGAGCTAGAAATAGC (SEQ ID NO.: 46) and pCas9- Kl ADH1-gRNA1-PR: GCCCTTGACGTTTTCACCCAAAAGTCCCATTCGCCACCCG (SEQ ID NO.: 47), using the pCAS plasmid as a template for PCR amplification. Take 17 µL of the amplification product, add 1 µL of Dpn I, 2 µL of 10 × digestion buffer, mix well for 37 o C warm bath for 3 h. Take 10 µL of Dpn I-treated product and add it to 50 µL DH5α competent cel...

Embodiment 3

[0288] Example 3 Site-directed mutation of ADH1 H47 site by CRISPR / Cas9

[0289] 3.1 Kl ADH1 CRISPR gRNA sequence determination

[0290] According to Kl ADH1 designed point mutation, select PAM sequence (NGG), and determine the corresponding gRNA sequence. The principle of gRNA selection in this example is: close to the designed mutation site, moderate GC content (40%-60%), and avoid the existence of poly T structure. In this example, KlADH1 The gRNA1 sequence is TGGGTGAAAACGTCAAGGGC (SEQ ID NO.:56).

[0291] Plasmid construction and transformation methods are as follows: use primer pCas9- Kl ADH1-gRNA1-PF: TGGGTGAAAACGTCAAGGGCGTTTTAGAGCTAGAAATAGC (SEQ ID NO.:57) and pCas9- Kl ADH1-gRNA1-PR: GCCCTTGACGTTTTCACCCAAAAGTCCCATTCGCCACCCG (SEQ ID NO.: 58), using the pCAS plasmid as a template for PCR amplification. Take 17 µL of the amplification product, add 1 µL of Dpn I, 2 µL of 10 × digestion buffer, mix well for 37 o C warm bath for 3 h. Take 10 µL of Dpn I-treated pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to an ADH (ethanol dehydrogenase) protein family mutant and an application thereof, and particularly provides a mutant of an ADH protein. Compared with wild type ADH proteins, the ADH protein mutant is capable of remarkably increasing expression purity, efficiency and yield of foreign proteins in a cell-free synthesis system in vitro, and / or reducing binding capacity of the mutant protein and the Ni medium.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to ADH protein family mutants and applications thereof. Background technique [0002] Protein separation and purification refers to the fusion of polytags or specific properties of the target protein at one end of the target protein, and the separation of other substances, The process of purifying the protein of interest. Affinity chromatography refers to the method of immobilizing one of the two molecules with affinity on an insoluble matrix, and using the specificity and reversibility of intermolecular affinity to separate and purify the other molecule. Commonly used polytags for affinity chromatography mainly include Histidine (His), Glutathione S-transferase (GST) and Maltose Binding Protein (MBP), etc. . The principle of immobilized metal-chelating affinity chromatography (IMAC) is mainly based on the fact that amino acid residues on the protein surface can form different affini...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/04C12N15/53C12P21/02
CPCC12N9/0006C12Y101/01001C12P21/02
Inventor 郭敏王海鹏姜灵轩娄旭许乃庆代田纯李海洋邓蜜妮于雪
Owner KANGMA SHANGHAI BIOTECH LTD