Cow lysozyme (Lyz) gene mammary gland specific expression recombinant plasmid as well as construction method and application thereof
A technology of recombinant plasmids and construction methods, which can be applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as drug-resistant strains endangering consumers' health, and difficult problems in the treatment of dairy cow mastitis, so as to treat and prevent mastitis, improve bacteriolysis The effect of enzyme expression and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] 1. Primer design and synthesis
[0047] According to the cDNA sequence of dairy cow Lyz gene in GenBank (GenBank No.: NM_180999.1) and β-lactoglobulin (BLG) gene sequence (GenBank No.: X14710.1), Oligo6.0 was used to design cow Lyz gene primers P1, P2, and β-lactoglobulin gene (BLG) promoter gene primers P3 and P4 were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd. The sequences are respectively (the underline is the homology arm):
[0048] P1: CTCAGATCTCGAGCTCAAGCTT CATGAAGGCTCTCCTCATT
[0049] P2: CATGGTGGCGACCGGTGGATCC CACTCCACAACCCTGAAT
[0050] P3: GCCATGCATTAGTTATTAAT AGGTGCTTTATTTCCGTCTC
[0051] P4: TGAGGAGAGCCTTCATAAGCT TACAGCCTCCCTTGGTCTC
[0052] 2. Acquisition of gene cloning template
[0053] (1) Genomic DNA extraction from dairy cow blood
[0054] Take 9ml fresh and healthy Chinese Holstein cow blood samples, and extract cow blood genomic DNA according to the operation method of the Whole Blood Genomic DNA Extraction Kit (purchas...
Embodiment 2
[0067] 1. Culture and count of Staphylococcus aureus strain (S.aureus)
[0068] Resuscitate the frozen Staphylococcus aureus, inoculate the LB medium with an inoculation loop, and put it into a 37°C constant temperature biochemical incubator for overnight culture; pick a single colony from the LB medium and inoculate it in the LB medium, put Into 37 ℃ constant temperature air bath shaker overnight culture. Collect the strains, resuspend the bacteria with DMEM high-sugar medium to make a bacterial suspension, and adjust the concentration of the bacterial suspension to 2×10 8 cfu / mL.
[0069] 2. Antibacterial effect of S.aureus challenged in vitro cultured dairy cow mammary epithelial cells
[0070] (1) Experimental grouping
[0071] The primary cultured dairy cow mammary gland epithelial cells were inoculated into 6-well cell culture plates and placed in CO 2 Cultivate in a constant temperature incubator. When the cells grow to 80% confluence, carry out the experimental gro...
Embodiment 3
[0084] 1. Transfection of Lyz recombinant plasmid in mice
[0085] (1) Experimental grouping
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com