Molecular typing method for distinguishing different strains of cronobacter through performing single enzyme digestion on gluA gene based on RsaI

A Cronobacter, molecular typing technology, applied in microorganism-based methods, biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of inability to effectively distinguish different Cronobacter Rapid identification of the source of bacterial contamination and high technical operation requirements can achieve the effect of clear enzyme cut bands, stable identification and high technical requirements.

Inactive Publication Date: 2020-01-17
HEFEI UNIV OF TECH
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, Cronobacter typing techniques mainly include antibiotic typing, phage typing, Enterobabcterial Repetitive Intergenic Consensus-PCR (ERIC-PCR), pulsed field gel electrophoresis (Pulsed Field Gel Electrophoresis, PFGE), random amplification Polymorphism (Random Applied Polymorphic DNA-PCR) and other technologies, these methods cannot effectively distinguish different species of Cronobacter genus, while multilocus sequence analysis (Multil℃us Sequencing Typing, MLST) can be used for Cronobacter Different species of the genus can be distinguished, but the operation is cumbersome and requires high technical operations (nucleic acid purification, sequencing and sequence comparison analysis), which takes a long time (at least 2 days for ordinary laboratories), which is not conducive to the contamination of the bacteria in the food processing process Rapid identification of source

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular typing method for distinguishing different strains of cronobacter through performing single enzyme digestion on gluA gene based on RsaI
  • Molecular typing method for distinguishing different strains of cronobacter through performing single enzyme digestion on gluA gene based on RsaI
  • Molecular typing method for distinguishing different strains of cronobacter through performing single enzyme digestion on gluA gene based on RsaI

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0023] A single enzyme digestion based on RsaI gluA The molecular typing method for genetically differentiating the different species of Cronobacter spp. is a two-stage experimental phase, the first as figure 1 Shown, amplified Cronobacter specific gluA Gene fragments, the second stage as figure 2 As shown, the Cronobacter specific gluA Gene fragments were obtained to obtain different enzyme digestion maps, and then to distinguish six different species of Cronobacter genus.

[0024] The specific operation steps are as follows:

[0025] (1) selection gluA Gene

[0026] gluA The gene encodes Cronobacter α-glucosidase.

[0027] (2 pairs gluA gene amplification

[0028] Use amplification primers F: 5'- AGGGATCCTGAAAGCAATCGACAAGAA -3'; R: 5'-CCGAAGCTTACTCATTACCCTCCTGATG -3' pair gluA Gene amplification to obtain six different bacteria of the genus Crobacter gluA Gene fragments, see figure 1 : Strains of six different species of Cronobacter gluA Amplified re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a typing method for distinguishing different strains of cronobacter through performing single enzyme digestion on gluA gene based on RsaI, and belongs to the technical field of microbiological examination of food. Operation steps of the method disclosed by the invention are divided into two stages: 1, in the first stage, specific primer amplification on the cronobacter isperformed, so that gluA gene fragments of six different strains of the cronobacter are obtained; and 2, in the second stage, the specific gluA gene fragments of the cronobacter, which is amplified inthe first stage, are subjected to RsaI enzyme digestion, so that differential PCR-RFLP fingerprint graphs of the six different strains of the cronobacter are obtained, and the different strains of thecronobacter are further distinguished. A large quantity of examples of strains of the cronobacter verify that by adopting the molecular typing method, the differential enzyme digestion polymorphic graphs of the different strains can be effectively obtained, and the six different strains of the cronobacter can be quickly and accurately distinguished. The molecular typing method disclosed by the invention is used for distinguishing the strains of the cronobacter, and has an important practical meaning on accurately tracing pollution of the cronobacter in the food.

Description

technical field [0001] The invention belongs to the technical field of food microbiological testing, and in particular relates to a molecular typing method for distinguishing different species of Cronobacter based on RsaI single-enzyme cutting gluA gene. Background technique [0002] Cronobacter ( Cronobacter ), are foodborne pathogens that can cause serious infections. The survey of food contamination data shows that infant formula milk powder is the main transmission medium of its infection. Currently, Cronobacter typing techniques mainly include antibiotic typing, phage typing, Enterobabcterial Repetitive Intergenic Consensus-PCR (ERIC-PCR), pulsed field gel electrophoresis (Pulsed Field Gel Electrophoresis, PFGE), random amplification Polymorphism (Random Applied Polymorphic DNA-PCR) and other technologies, these methods cannot effectively distinguish different species of Cronobacter genus, while multilocus sequence analysis (Multil℃us Sequencing Typing, MLST) can be u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/683C12Q1/04C12R1/01
CPCC12Q1/689C12Q1/683C12Q2600/156
Inventor叶应旺汪馨沈益忠张丹凤蒋秀婷董晶晶
OwnerHEFEI UNIV OF TECH