High-throughput anti-echinococcosis drug screening method based on echinococcus microtubulin as targets

A technology for tubulin and echinococcosis, applied in the field of biomedicine, can solve the problems of high research cost, poor absorption, low cure rate, etc.

Active Publication Date: 2020-01-21
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the treatment drugs recommended by the World Health Organization (WHO) include albendazole and mebendazole, but they still have shortcomings such as poor absorption, long medication cycle and low cure rate (only 30%)
It can be seen that the existing clinical drugs are difficult to meet the needs of patients.
In addition, the existing echinococcosis drug research has problems such as low screening efficiency and high research cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-throughput anti-echinococcosis drug screening method based on echinococcus microtubulin as targets
  • High-throughput anti-echinococcosis drug screening method based on echinococcus microtubulin as targets
  • High-throughput anti-echinococcosis drug screening method based on echinococcus microtubulin as targets

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1: Construction of pET30a-EgTUA9 and pET30a-EgTUB4 plasmid vectors of genetically engineered bacteria (see figure 1 Steps 1, 2, 3)

[0054] (1) Using Echinococcus granulosus cysts from sick sheep in epidemic areas as materials, collect protoscolmets under sterile conditions. The protoscole was stained with 0.1% methylene blue solution, and observed with an inverted microscope, and the protoscole with activity greater than 95% was used for subsequent experiments.

[0055] (2) Use the RNA extraction kit to extract protoscole RNA, and use the cDNA reverse transcription kit to obtain the cDNA of Echinococcus granulosus; using the above cDNA as a template, use the upstream primer CGCGAGCTCATGCGTGAATGTATCAGTAT of EgTUA9 (the underlined part is Sac I Restriction site), the downstream primer AGCGGCCGCTTAGTACTCCTCGCCCTCTT (the underlined part is the restriction site of NotI) amplifies the EgTUA9 fragment (1356bp). PCR reaction conditions: 95°C pre-denaturation for 5...

Embodiment 2

[0060] Embodiment 2: Transformation of genetically engineered bacteria recombinant plasmid and induced expression of protein (see figure 1 Step 4)

[0061] (1) Taking pET30a-EgTUA9 and pET30a-EgTUB4 as examples, describe the transformation of recombinant plasmids of genetically engineered bacteria and the induced expression of proteins. ), incubated on ice for 30min, then heat-shocked at 42°C for 90s, immediately placed on ice and incubated for 3min, then added an appropriate amount of non-resistant LB liquid medium to mix, shaken and cultured at 37°C for 45min, and then applied to 50μg / mL Kanamycin LB solid plate, cultured upside down at 37°C overnight.

[0062] (2) Pick a single clone and use 5 mL of LB liquid culture containing 50 μg / mL kanamycin to culture overnight at 37°C with shaking; perform colony PCR verification on the single clone respectively, and the results are as follows figure 2 As shown, a band in line with the expected target fragment size appeared; and th...

Embodiment 3

[0064] Embodiment 3: recombinant tubulin expression verification (see figure 1 step 5)

[0065] (1) Before protein induction, take 1 mL of bacterial liquid as the non-induced group, after shaking culture, take 1 mL of bacterial liquid as the induced group, and centrifuge the bacterial liquid of the uninduced group and the induced group to collect the bacterial pellet, add the loading buffer liquid and mix well, set aside. Centrifuge the remaining bacterial liquid to collect the bacterial pellet, resuspend in buffer A (20mM Tris-HCl, 300mM NaCl, 10mM imidazole, pH7.4), and perform ultrasonication on ice, centrifuge at 12000rpm for 20min, and collect The supernatant and the precipitate were dissolved in buffer B (20mM Tris-HCl, 300mM NaCl, 10mM imidazole, 8M urea, pH 7.4), and an appropriate amount of supernatant and precipitation solution were taken respectively and added into an equal volume of loading buffer , respectively marked as supernatant group and precipitation group...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-throughput anti-echinococcosis drug screening method based on echinococcus granulosus and echinococcus multilocularis microtubulin as targets. The high-throughput anti-echinococcosis drug screening method includes the following steps that each 14 alpha-microtubulin homologues genes and 11 beta-microtubulin homologues genes of echinococcus granulosus and echinococcusmultilocularis are separately connected to plasmid vectors, and protein-expressing genetically engineered bacteria containing the plasmid vectors are obtained; expression and purification of the microtubulin are recombined; and the in vitro polymerization effect of the microtubulin is completed, the recombinant microtubulin is co-incubated with drugs to be tested to screen new anti-echinococcosisdrugs through the effect of drugs on the recombinant microtubulin in vitro polymerization. According to the high-throughput anti-echinococcosis drug screening method based on the echinococcus granulosus and echinococcus multilocularis as the targets, by evaluating the promotion or inhibition effect of the drug on microtubulin polymerization, the anti-echinococcosis drugs based on the microtubulincan be efficiently, easily and economically screened in a high-throughput mode. A novel idea is provided for the screening of the anti-echinococcosis drugs, and the high-throughput anti-echinococcosisdrug screening method can be used for finding effective new drugs or leading compounds for the treatment of the echinococcosis.

Description

technical field [0001] The invention relates to a drug screening method, in particular to a high-throughput anti-echinococcosis drug screening method based on echinococcosis tubulin as a target, and belongs to the field of biomedicine. Background technique [0002] Hydatid diseases, also known as Echinococcosis, are parasitic in humans, artiodactyls and rodents, etc. Zoonotic diseases caused by intermediate hosts, among which E. granulosus (Eg) and multilocularis (E. multilocularis, Em) are the two most important pathogens [Reference: Qi Yan Feng, Wu Weiping. Epidemiological research progress of echinococcosis[J]. Chinese Journal of Parasitology and Parasitic Diseases, 2013, 31(2):143-148; Maimaitijiang Wumaier, Adili • Sima Yi, Islam Usman, et al. Epidemiological survey of echinococcosis in the Xinjiang Uygur Autonomous Region in 2012 [J]. Chinese Journal of Parasitology and Parasitic Diseases, 2016, 34(3): 249-254.]. Echinococcosis presents a global distribution. The th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/50C12N15/12C12N15/70C07K14/435C07K1/22
CPCG01N33/5005G01N33/5023C07K14/43554C12N15/70
Inventor刘丛珊姚嘉青张皓冰陶奕薛剑尹建海
OwnerSTATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT