Purpose of porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection

An interleukin, cell technology, applied in the field of biotechnology genetic engineering

Active Publication Date: 2020-02-04
NANJING AGRICULTURAL UNIVERSITY
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no research to show whether IL11 can alleviate the intestinal inflammatory damage caused by PEDV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Purpose of porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection
  • Purpose of porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection
  • Purpose of porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Effect of PEDV infection on IL-11 secretion

[0037] 1. Effect of PEDV infection on IL-11 secretion of Vero E6 cells

[0038] After Vero E6 cells were infected with PEDV at MOI=0.1, cellular RNA (Trizol method) and protein samples (RIPA lysis) and cell supernatant were collected at different times. The expression of IL-11 mRNA in Vero E6 cells infected with the virus at different time points was detected by fluorescent quantitative PCR. The quantitative primers of IL-11 and the primers of the internal reference gene GAPDH are shown in Table 1. The results showed that at different times (8h, 24h, 36h and 48h) after PEDV infection, the expression level of IL-11mRNA in Vero E6 cells was significantly higher than that of the negative control group (Mock). Compared with the control group, the expression level has a very significant difference (Pfigure 1 A). Use the ELISA method to detect the secretion level of IL-11 in the cell supernatant, and the results show t...

Embodiment 2

[0045] Example 2 Construction of recombinant plasmid pET-32a(+)-pIL-11

[0046] 1. Obtaining the recombinant porcine interleukin-11 gene fragment

[0047] Total mRNA was extracted from porcine small intestine by the Trziol method, and total cDNA was synthesized according to the instructions of the reverse transcription kit. Amplify the cDNA of porcine IL-11 in the cDNA by primers, and design primers with reference to porcine IL-11mRNA (XM_021095008.1) in NCBI as follows:

[0048] P1: GTGGTGGTGCTCGAGCAGCCGAGTCTT (SEQ ID NO: 17)

[0049] P2: GCTGATATCGGATCCATGAACAGTGTTT (SEQ ID NO: 18)

[0050] The above primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0051] 2. Construction of recombinant plasmid pET-32a(+)-pIL-11

[0052] After successfully amplifying the full-length 600bp IL-11 gene fragment using porcine intestinal cDNA, it was recovered after agarose gel electrophoresis, and the fragment was double-digested with restriction endonucleases EcoRI and...

Embodiment 3

[0054] Example 3 Verification of recombinant Escherichia coli E.coli BL21 expressing porcine interleukin 11

[0055] Pick a single colony of the constructed porcine IL-11 recombinant bacteria and inoculate it into 5ml of liquid LB with ampicillin resistance (50μg / m1), shake overnight at 180rpm in a shaker at 37°C, and take 500μl of overnight cultured Bacteria were cultured in 100ml of new LB liquid medium with ampicillin resistance (50μg / ml) under the same conditions until OD600 was 0, 6, 8. At this time, the group culture began. The experimental group was added with IPTG at a final concentration of 1 mmol / L, while the control group was not added. The culture was induced in a shaker for 6 hours under the same conditions. Then, take out the bacterial liquid, centrifuge at 8000rpm for 5min, collect the bacteria, and suspend them with 1×PBS buffer. Sonicate on ice, power 300W, work for 4s and stop for 6s, total time 3min, 4°C, 12000rpm, centrifuge the crushed bacterial solution ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a porcine interleukin 11, and a purpose of the porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection. After porcine epidemic diarrhea virus infection happens, a piglet intestinal tract secretes cell factor porcine pIL-11 which is obviously improved, and the expression of the cell factor exhibits high correlation with a virus infection level. The invention discloses a prokaryotic expression plasmid for constructing a recombinant pIL-11, a transformed escherichia coli BL21, and a specific method for obtaining a high-purity recombinant pIL-11 through purification. The recombinant pIL-11 can inhibit the infection of the PEDV (Porcine epidemic diarrhea virus) for a host cell, and has obvious dose dependency. The recombinant pIL-11 activates a STAT3 (signal transducer and activator of transcription 3) signal to inhibit host cell apoptosis induced after PEDV infection happens so as to perform a function of resisting virus infection. The porcinesource IL-11 has a function of resisting virus infection and alleviating piglet intestinal tract injury, and is expected to become an effective medicine for resisting PEDV intestinal tract infectionin the future.

Description

technical field [0001] The invention belongs to the field of biotechnology genetic engineering, and relates to the antiviral use of porcine interleukin-11, in particular to the use of porcine interleukin-11 in resisting porcine epidemic diarrhea virus infection. Background technique [0002] 1. Research progress on porcine interleukin-11 [0003] Interleukin IL-11 (Interleukin-11, IL-11) is a member of the IL-6 family, which can be produced by various cells in the body, such as immune cells, fibroblasts, smooth muscle cells, endothelial cells, epithelial cells and bone marrow stromal cells Secreted. The initial research on the physiological role of IL-11 mainly focused on its regulation of hematopoietic function, T and B lymphocyte immune function, and nervous system development. Some studies in recent years have shown that IL-11 also plays an important role in the maintenance of the intestinal mucosal barrier. It can play anti-apoptosis, promote proliferation, inhibit inf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/54C12N15/24C12N15/70C12N1/21A61K38/20A61P31/14C12R1/19
CPCA61K38/00A61P31/14C07K14/5431C12N15/70
Inventor 李昱辰杨倩吴顷新郑健王玉昊
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap