Purpose of porcine interleukin 11 in resisting porcine epidemic diarrhea virus infection
An interleukin, cell technology, applied in the field of biotechnology genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Effect of PEDV infection on IL-11 secretion
[0037] 1. Effect of PEDV infection on IL-11 secretion of Vero E6 cells
[0038] After Vero E6 cells were infected with PEDV at MOI=0.1, cellular RNA (Trizol method) and protein samples (RIPA lysis) and cell supernatant were collected at different times. The expression of IL-11 mRNA in Vero E6 cells infected with the virus at different time points was detected by fluorescent quantitative PCR. The quantitative primers of IL-11 and the primers of the internal reference gene GAPDH are shown in Table 1. The results showed that at different times (8h, 24h, 36h and 48h) after PEDV infection, the expression level of IL-11mRNA in Vero E6 cells was significantly higher than that of the negative control group (Mock). Compared with the control group, the expression level has a very significant difference (Pfigure 1 A). Use the ELISA method to detect the secretion level of IL-11 in the cell supernatant, and the results show t...
Embodiment 2
[0045] Example 2 Construction of recombinant plasmid pET-32a(+)-pIL-11
[0046] 1. Obtaining the recombinant porcine interleukin-11 gene fragment
[0047] Total mRNA was extracted from porcine small intestine by the Trziol method, and total cDNA was synthesized according to the instructions of the reverse transcription kit. Amplify the cDNA of porcine IL-11 in the cDNA by primers, and design primers with reference to porcine IL-11mRNA (XM_021095008.1) in NCBI as follows:
[0048] P1: GTGGTGGTGCTCGAGCAGCCGAGTCTT (SEQ ID NO: 17)
[0049] P2: GCTGATATCGGATCCATGAACAGTGTTT (SEQ ID NO: 18)
[0050] The above primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd.
[0051] 2. Construction of recombinant plasmid pET-32a(+)-pIL-11
[0052] After successfully amplifying the full-length 600bp IL-11 gene fragment using porcine intestinal cDNA, it was recovered after agarose gel electrophoresis, and the fragment was double-digested with restriction endonucleases EcoRI and...
Embodiment 3
[0054] Example 3 Verification of recombinant Escherichia coli E.coli BL21 expressing porcine interleukin 11
[0055] Pick a single colony of the constructed porcine IL-11 recombinant bacteria and inoculate it into 5ml of liquid LB with ampicillin resistance (50μg / m1), shake overnight at 180rpm in a shaker at 37°C, and take 500μl of overnight cultured Bacteria were cultured in 100ml of new LB liquid medium with ampicillin resistance (50μg / ml) under the same conditions until OD600 was 0, 6, 8. At this time, the group culture began. The experimental group was added with IPTG at a final concentration of 1 mmol / L, while the control group was not added. The culture was induced in a shaker for 6 hours under the same conditions. Then, take out the bacterial liquid, centrifuge at 8000rpm for 5min, collect the bacteria, and suspend them with 1×PBS buffer. Sonicate on ice, power 300W, work for 4s and stop for 6s, total time 3min, 4°C, 12000rpm, centrifuge the crushed bacterial solution ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap