Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of serine hydroxymethyltransferase mutant and its application

A serine hydroxymethyl, mutant technology, applied in the field of enzyme catalysis, can solve problems such as high price and limited application, and achieve the effect of improving enzyme activity

Active Publication Date: 2021-04-13
ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Serine is one of the important natural moisturizing factors (NMF), the main role of skin stratum corneum to maintain moisture, so it is a key additive in many advanced cosmetics, but its high price limits its application in cosmetics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of serine hydroxymethyltransferase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1 Construction of wild-type serine hydroxymethyltransferase expression strain

[0050] 1.1 For the serine hydroxymethyltransferase SHMT (UniProtKB-P0A825) gene derived from Escherichia coli (Escherichia coli), which is SEQ ID NO: 2, entrust Suzhou Jinweizhi Biotechnology Co., Ltd. to synthesize the entire gene sequence of SEQ ID NO: 2, It was constructed into a pSH plasmid (Zhejiang Huarui Biotechnology Co., Ltd.) to obtain an expression vector pSH-SHMT expressing wild-type serine hydroxymethyltransferase SEQ ID NO:1.

[0051] Forward primer SHMT-F: CATATG TTAAAGCGTGAAATGAA

[0052] Reverse primer SHMT-R: GGATCC TTATGCGTAAACCGGGTAAC

[0053] PCR amplifies about 1.2kb fragment, PCR reaction system includes, 0.3μM each primer, 50ng template, 1xKOD Neoplus buffer, 0.2mM dNTP, 1.5mM MgSO 4 , KOD neo plus 1U, add double distilled water to make the total system 50μl.

[0054] PCR conditions: 94°C, 2min; 98°C for 10s, 55°C for 30s, 68°C for 30s, repeated for...

Embodiment 2

[0056] Embodiment 2 constructs SHMT random mutation point library and screening by error-prone PCR method

[0057] 2.1 Construction of SHMT random mutation point library by error-prone PCR method

[0058] Using the sequence SEQ ID NO: 2 as a template, an SHMT random mutant library was constructed using error-prone PCR technology. SHMTmu-F is 5'- ATG TTAAAGCGTGAAATGAA-3', the reverse primer SHMTmu-R is 5'-TTATGCGTAAACCGGGTAAC-3'.

[0059] 50μL error-prone PCR reaction system includes: 50ng plasmid template pSH-SHMT, 30pmol pair of primers SHMTmu-F and SHMTmu-R, 1X Taq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mM dTTP, 7mM MgCl 2 , (0mM, 0.05mM, 0.1mM, 0.15mM, 0.2mM) MnCl 2 , 2.5 units of Taq enzyme (Fermentas). The PCR reaction conditions were: 95°C for 5 minutes; 30 cycles of 94°C for 30s, 55°C for 30s, 72°C for 2min / kbp; 72°C for 10min. The 1.2kb random mutation fragment was recovered from the gel as a large primer, and MegaPrimer PCR was performed with KOD-plus DNA po...

Embodiment 3

[0078] Embodiment 3 Mutant bacterial strain construction

[0079] The focus was on the mutant SHMT-382, and its ability to catalyze the reaction of glycine and formaldehyde to produce L-serine was investigated. To this end, the SHMT-382 gene SEQ ID NO:4 was cloned into the pSH plasmid to obtain the expression vector pSH-SHMT-382 expressing the serine hydroxymethyltransferase mutant SEQ ID NO:3.

[0080] Using the plasmid pSH-SHMT-382, it can be constructed into different expression systems, such as Escherichia coli, Pichia pastoris, and Bacillus subtilis. For example, transform the plasmid pSH-SHMT-382 into BL21(DE3) competent cells, spread on kan+LB plate, culture overnight at 37°C, pick 10 single colonies, inoculate into a test tube containing LB liquid medium, and culture at 37°C Overnight, the bacteria were collected by centrifugation, the plasmid was extracted, and the gene sequence was confirmed to confirm that the mutation was correct, and the engineered bacteria were ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a serine hydroxymethyltransferase mutant whose amino acid sequence is SEQ ID NO: 3. Compared with the wild-type serine hydroxymethyltransferase, the enzyme activity of catalyzing the reaction of glycine and formaldehyde to produce serine is improved. It has the prospect of industrialized development and application.

Description

technical field [0001] The invention belongs to the technical field of enzyme catalysis, and in particular relates to a serine hydroxymethyltransferase mutant and its use for enzymatically catalyzing the condensation reaction of glycine and formaldehyde to generate L-serine. Background technique [0002] L-serine, also known as 2-amino-3-hydroxypropionic acid, CAS 56-40-6. L-serine is one of the amino acids for the synthesis of proteins, a non-essential amino acid for mammals, an aliphatic polar α-amino acid, and a ketogenic amino acid. [0003] Although L-serine is a non-essential amino acid, it has many important physiological functions and effects, so it is widely used in medicine, food and cosmetics. Serine is one of the important natural moisturizing factors (NMF), the main role of the skin stratum corneum to maintain moisture, so it is a key additive in many advanced cosmetics, but its high price limits its application in cosmetics. L-serine is widely used in the pre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/70C12N1/21C12P13/06
CPCC12N9/1014C12N15/70C12P13/06
Inventor 范文超高书良王金刚俞想
Owner ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com