Method for detecting mutation rate of JAK2 V617F as well as special primer and probe thereof
A technology of JAK2V617F and detection probes, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of inability to completely eliminate non-specific amplification reactions, detection sensitivity limitations, etc., and achieve result interpretation Simple and accurate, high sensitivity, avoid pollution effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Primer probe design and screening
[0058] In the present invention, by designing specific primers and Taqman fluorescent probes for detecting JAK2 gene wild and V617F mutation sites, real-time fluorescent PCR method is used to quantitatively detect JAK2 gene wild and V617F mutations in human peripheral blood or bone marrow genomic DNA, and calculate Percentage of wild type and mutant type. The present invention firstly designs the upstream mutation of JAK2 and the wild primer, and mutates the base before the mutation site (G>T) to obtain better specific amplification. The combination of different mutation bases at the 3' end will affect the amplification. Therefore, the previous base of the mutation site was mutated to T, C, and G in sequence to obtain three pairs of primer-probe combinations. Add these two primers and the 3'-end common primer to perform two parallel PCRs. Only the primers that are completely complementary to the wild or mutant site (G / T) D...
Embodiment 2
[0064] Embodiment 2: Construction of mutant plasmid reference product and wild plasmid reference product
[0065] According to the upstream and downstream primers designed in Example 1, select the amplified fragment and about 100 bp upstream and downstream of the amplified fragment to construct the mutant plasmid reference product and the wild plasmid reference product respectively. Plasmids were constructed by Shanghai Jierui Bioengineering Co., Ltd. The sequence of the JAK2 gene fragment (>gi|568815589:5073611-5074001) inserted in the wild plasmid reference product is shown in SEQID NO.14; the sequence of the JAK2 gene fragment (>gi|568815589:5073611-5074001) inserted in the mutant plasmid reference product As shown in SEQ ID NO.15.
[0066] 5’-GCATCTTTATTATGGCAGAGAGAATTTTCTGAACTATTTATGGACAACAGTCAAACAACAATTCTTTGTACTTTTTTTTTTCCTTAGTCTTTCTTTGAAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCATCTGTTTTTGTTTATAT...
Embodiment 3
[0072] Example 3: A kit for detecting the mutation rate of JAK2 V617F
[0073] 1. Kit composition:
[0074] (1) PCR reaction tube 1, comprising:
[0075] name sequence modify JAK2 upstream wild primer 5'-AGCATTTGGTTTTAAAATTATGGAGTATGAG-3' — Common primers downstream of JAK2 5'-CTAGCTGTGATCCTGAAACTGAATT-3' — JAK2 detection probe TGCCTTTTCTCAGAGCATCTGT 5'-FAM; 3'-MGB JAK2 mutation blocking probe TGGAGTATGTTTCTGTGGAGA 3'-MGB GAPDH upstream primer 5'-CCCACTCCTCCCACCTTTGAC-3' — GAPDH downstream primer 5'-CTGGCCCCAGCCACATAC-3' — GAPDH probe CATTGCCCTCAACGACCACTTTGTCAAGC 5'-HEX; 3'-TAMRA
[0076] (2) PCR reaction tube 2, comprising:
[0077] name sequence modify JAK2 upstream mutation primers 5'-AGCATTTGGTTTTAAAATTATGGAGTATGAT-3' — Common primers downstream of JAK2 5'-CTAGCTGTGATCCTGAAACTGAATT-3' — JAK2 detection probe TGCCTTTTCTCAGAGCATCTGT 5'-FAM; 3'-MGB JAK2 wi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


