Novel coronavirus visual constant-temperature rapid detection kit

A coronavirus and kit technology, which is applied in the field of visual constant temperature (nucleic acid extraction-free) rapid detection kits for new coronaviruses, can solve the problems of difficult amplification and inability to amplify long-chain RNA, and achieve accurate detection and good application prospects. Effect

Inactive Publication Date: 2020-04-10
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF0 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since LAMP amplification is strand displacement synthesis, the length of the target sequence is within 300bp, and it is difficult to amplify if the length of the target sequence is greater than 500bp, so long-chain RNA cannot be amplified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel coronavirus visual constant-temperature rapid detection kit
  • Novel coronavirus visual constant-temperature rapid detection kit
  • Novel coronavirus visual constant-temperature rapid detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Acquisition of Primers for Novel Coronavirus Constant Temperature Rapid Nucleic Acid Amplification Technology

[0043] In this example, for the highly conserved fragment (SEQ ID NO:7) of the new coronavirus (2019-nCoV), according to the principle of LAMP primer design, the LAMP Desiner2.0 software was used to design 6 primer combinations, and the primers were analyzed by RNAMAN. Three candidate primer combinations were picked out (Table 1).

[0044]

[0045]Due to the presence of non-specific amplification in both group II and group III primer combinations, the present invention finally determines that the 6 specific primers in the kit for detecting novel coronavirus 2019-nCoV are the following combinations (SEQ ID NO: 1-6) :

[0046] Outer forward primer Co5-153-F3: AACATGGAGGAGGTGTTG

[0047] Outer reverse primer Co5-153-B3: CAAGTAGAACTTCGTGCTG

[0048] Inner forward primer Co5-153-FIP: AAACACAACTACCACCCACTTTTGCCATGCAAGTTGAATC

[0049] Inner reverse p...

Embodiment 2

[0052] Example 2 Establishment of New Coronavirus Constant Temperature Rapid Nucleic Acid Amplification Technology Method

[0053] Using the primer combination determined in Example 1, perform constant temperature and rapid nucleic acid amplification technology on the positive plasmid of the new coronavirus.

[0054] Add 20 µL ddH to the bottom of the reaction tube 2 O, add 20 µL of OG reaction reagent, gently pipette once with the tip of the pipette, and mix well. Then add 20 μL of sample soaking solution (throat swab soaking solution sample) to the reaction tube, mix well, and finally add 10 μL of LOG dye (purchased from Harbin Xinhai Genetic Testing Co., Ltd.).

[0055] The preparation method of the OG reaction reagent is as follows: 50 mg of the OG freeze-dried reaction reagent is dissolved in 650 μl of reaction buffer to obtain the OG reaction reagent.

[0056] Wherein, the composition of reaction buffer is as follows:

[0057] Tris-HCl 20mM, pH8.8

[0058] MgSO 4 6...

Embodiment 3

[0070] Embodiment 3 Sensitivity experiment

[0071] The new coronavirus positive plasmid was diluted 10 times, and the dilution was 10 -1 to 10 -7 Seven dilutions were performed according to the method established in Example 2 to perform the constant temperature rapid nucleic acid amplification technology to determine the sensitivity of the constant temperature rapid nucleic acid amplification detection technology established in the present invention.

[0072] The results of the sensitivity analysis showed that the T7P primer (5'- AAGCTTCTAATACGACTCACTATAGGGAG-3') and the pJET-R primer (5'- AAGAACATCGATTTTCCATGGCAG -3') Amplify the plasmid containing the viral nucleic acid sequence, and the amplified product ( figure 1 ) was inserted into the multiple cloning site of the pJET plasmid, and the 2019 nCoV-pJET standard plasmid was constructed as a detection template.

[0073] PCR amplification system: 5×G5 PCR Mix 10 μl, 10 μM T7P 1 μl, 10 μM pJET-R 1 μl, plasmid containing vi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a novel coronavirus visual constant-temperature (nucleic acid extraction-free) rapid detection kit. According to the invention, a specific nucleic acid sequence of a novel coronavirus (2019-nCoV) is used as a target gene; LAMP amplification primers are designed; a novel coronavirus constant-temperature rapid nucleic acid amplification technology detection method is established on the basis of the advantages of high specificity, high sensitivity, simplicity and convenience of a loop-mediated isothermal amplification technology; and a visual constant-temperature novel coronavirus rapid detection kit is constructed on the basis of the detection method. The kit provided by the invention can effectively detect standard plasmids with a concentration of 5 copies / [mu]l, andhas a reaction time of only 30 minutes. The kit provided by the invention can achieve the purpose of quickly and accurately detecting the novel coronavirus, and has good application prospect.

Description

technical field [0001] The invention relates to the technical field of nucleic acid detection, in particular to a rapid detection kit for a novel coronavirus at constant temperature (without nucleic acid extraction). Background technique [0002] Novel coronavirus is a virus newly discovered since December 2019, which can cause viral pneumonia / lung infection in humans, and was named "2019-nCoV" by the World Health Organization on January 12, 2020. At present, the detection method of the new coronavirus is a nucleic acid detection method, and ordinary PCR and fluorescent quantitative PCR are commonly used. The application of these detection methods for the detection of new coronaviruses not only requires high equipment and laboratory environment, but also has a complicated operation process, strict technical requirements for operators, and a long detection time. Especially limited by the limitations of grass-roots detection equipment and personnel, which seriously affected t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/701C12Q2531/119C12Q2563/107C12Q2565/125C12Q2565/113
Inventor 崔尚金梁琳贾亚雄梁瑞英
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap