Recombinant antibody of anti-human cardiac troponin I

A troponin and antibody technology, applied in the field of immunity, can solve the problems of low activity and poor affinity, and achieve the effect of high affinity and strong binding protein activity

Active Publication Date: 2020-04-17
DONGGUAN PENGZHI BIOTECH CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Due to low activity and poor affinity, the existing cTnI antibodies cannot be well applied to the detection of cTnI protein. Therefore, there is a strong demand in this field for antibodies that can effectively and specifically bind to and detect cTnI

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant antibody of anti-human cardiac troponin I
  • Recombinant antibody of anti-human cardiac troponin I
  • Recombinant antibody of anti-human cardiac troponin I

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] This example provides an exemplary preparation method of a recombinant antibody against human cardiac troponin I.

[0114] S10, construction of expression plasmids:

[0115] Wherein, restriction endonuclease and Prime Star DNA polymerase were purchased from Takara Company in this embodiment;

[0116] MagExtractor-RNA extraction kit was purchased from TOYOBO; BD SMART TM The RACE cDNA Amplification Kit was purchased from Takara;

[0117] The pMD-18T vector was purchased from Takara;

[0118] The plasmid extraction kit was purchased from Tiangen Company;

[0119] Primer synthesis and gene sequencing were completed by Invitrogen;

[0120] S11, design and synthesis of primers:

[0121] 5' RACE upstream primers for amplification of heavy and light chains:

[0122] Amplify Heavy Chain and Light Chain 5'RACE Primers:

[0123] SMARTER II A Oligonucleotide:

[0124] 5'>AAGCAGTGGTATCAACGCAGAGGTACXXXXX<3';

[0125] 5'-RACE CDS Primer (5'-CDS):

[0126] 5’>(T) 25 VN<3'(N...

Embodiment 2

[0152] The antibody obtained in Example 1 (with sequences such as light chain and heavy chain shown in SEQ ID NO: 11 and 12) was analyzed, and the complementarity determining region (WT) of the heavy chain:

[0153] CDR-VH1 is G-F-T-Y(X1)-S-N-Y-A-M-S;

[0154] CDR-VH2 is I-S-T(X1)-G-G-S-Y-S-Y(X2)-Y-P-D-S-V-K;

[0155] CDR-VH3 is A-R-K(X1)-D-N-Y-Y(X2)-G-S-T(X3)-F-M-D-Y;

[0156] Complementarity-determining regions of the light chain:

[0157] CDR-VL1 is R-A-S-Q-D(X1)-I-T-Q(X2)-Y-L-N;

[0158] CDR-VL2 is I-Y-Y-S(X1)-S-R-I(X2)-H-S-G-V-S;

[0159] CDR-VL3 is Q-Q-G-N(X1)-T-I(X2)-P-L-T;

[0160] Among them, X1, X2, and X3 are mutation sites.

[0161] Table 1 Mutation sites related to antibody activity

[0162]

[0163] The inventors mutated the CDR sites in WT to obtain antibodies with better activity.

[0164] Dilute the CTNI quality control recombinant antigen to 1ug / ml in the coating solution to coat the microplate, 100uL per well, overnight at 4°C; the next day, wash t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel isolated binding protein containing a cTnI antigen binding domain, and researches of the preparation, the applications and the like of the binding protein. The bindingprotein is high in activity, has high affinity with human cTnI protein, and can be widely applied to the field of cTnI protein detection.

Description

technical field [0001] The invention relates to the technical field of immunization, in particular to a recombinant antibody against human cardiac troponin I. Background technique [0002] Before the 1980s, the World Health Organization (WHO) has always regarded myocardial enzyme activity as one of the diagnostic criteria for acute myocardial infarction (AMI). In the late 1980s, researchers discovered that the sensitivity and specificity of troponin (Tn) was higher than that of phosphocreatine kinase (CK), phosphocreatine kinase isoenzyme (CK-MB), lactate dehydrogenation enzymes and biomarkers such as aspartate aminotransferase. Cardiac troponin I (cTnI) exists only in the myocardium and is a marker of cardiomyocytes. Its abnormal changes can affect the diastolic and systolic functions of the heart, and can be used to diagnose myocardial necrosis and judge myocardial injury. One of the most specific markers is recognized as the main biochemical marker for the rapid diagnos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/18C12N15/13G01N33/68
CPCC07K16/18G01N33/6893C07K2317/565C07K2317/92G01N2800/324G01N2800/325G01N2800/12G01N33/6887G01N33/577
Inventor崔鹏何志强孟媛韩日才钟冬梅范凌云
OwnerDONGGUAN PENGZHI BIOTECH CO LTD