Unlock instant, AI-driven research and patent intelligence for your innovation.

slc12a9 gene knockout mouse model and its establishment method and application

A gene knockout mouse, slc12a9 technology, applied to other methods of inserting foreign genetic materials, genetic engineering, biochemical equipment and methods, etc., to achieve the effect of simple production, good repeatability and low production cost

Active Publication Date: 2022-02-18
THE SECOND HOSPITAL AFFILIATED TO WENZHOU MEDICAL COLLEGE
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the relationship between Slc12a9 and hypertension in the world. Establishing a Slc12a9 gene knockout mouse model has important practical significance for elucidating the pathogenesis of hypertension.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • slc12a9 gene knockout mouse model and its establishment method and application
  • slc12a9 gene knockout mouse model and its establishment method and application
  • slc12a9 gene knockout mouse model and its establishment method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Establishment of SLC12A9 Knockout Mouse Model

[0024] one, Cas9 Mixing System

[0025] 1. sgRNA design.

[0026] Such as figure 1 with 2 As shown in the construction strategy diagram, a section of the genome sequence of the knockout SLC12A9 gene is determined, and the knockout genome sequence includes exon No. 5 (Exon5), exon No. 6 (Exon6) and exon No. 7 ( Exon7), its coding region sequence is as follows:

[0027] Exon5:ATGCCACAGGCTCCAGTGGGATCCAGGTTCTACCCCAGGGTTATGGCTGGAATCTGCTC TATGGCTCCCTTCTGCTGGGCCTCGTGGGTGGTGTGTGCACTTTGGGAGCTGGGCTCTATGCCCGAGCC TCCTTTCTTACATTCCTGCTGGTTTCTGGCTCCCTGGCCTCCGTGCTGGTCAGTTTTGTGGCAGTGGGA CCCAGGAACATCCCGTTAGCTCCTCGACCGGGCACCAATGCTTCCTCCGTGCCACACCGGCATGGCCAC TTCACTGGGTTCAACGGAAGCACCCTAAGGGACAACTTAGGTG

[0028] Exon 6: CTGGCTACGCCGAGGACTACACCACAGGGGCCATGATGACTTTCGCCAGTGTTTTTGCT GTCCTCTTCAACGGCTGCACGGGCATCATGGCTGGGGCCAACATGTCAG

[0029] Exon 7: GGGAGCTGAAGGACCCCAGCCGGGCAATTCCTCTGGGCACCATCATTGCAGTCGCCTATACCTTCTTCATCTACATCCTGCTGT...

Embodiment 2

[0088] Example 2 analyzes the blood pressure of F1 generation positive mice.

[0089] The results of the analysis are shown in Table 4 below.

[0090] Blood pressure measurement method: the mouse tail pressure measurement method was adopted, and the mice were under the awake state, and the BP2000 system of Visitech Systems was used to measure the blood pressure of the mice without intervention.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Slc12a9 gene knockout model mouse, a breeding method thereof, and the use of the mouse model in studying the pathogenesis of hypertension. The model mice are knocked out of exon 5, exon 6 and exon 7 in the SLC12A9 gene. The cultivation method of the invention is simple, the model is simple to make, the repeatability is good, and the manufacturing cost is low. The clinical manifestations are similar to that of human hypertension, and the studies that can be used for human hypertension have important practical significance for elucidating the pathogenesis of hypertension. The study also showed that the model provides a new model for tumor research and can be used as an indicator for predicting the prognosis of glioma patients. Therefore, it has good promotion and application value.

Description

technical field [0001] The present invention relates to a mouse model, especially a method for cultivating a Slc12a9 gene knockout mouse and an application of the mouse model. Background technique [0002] High blood pressure affects vital organs and structures such as our arteries and heart. If it develops for a long time, it will also cause life-threatening symptoms such as myocardial infarction and stroke. The prevalence of hypertension in my country has reached 23%. At present, the mechanism leading to hypertension is not yet clear. [0003] Slc12a9 is widely distributed on the cell membrane of cells in the body, mediates the transport of sodium ions, potassium ions, and chloride ions inside and outside the cells, and is closely related to the osmotic pressure inside and outside the cells. SLC family proteins play an important role in the occurrence and development of tumors. In the prior art, the Slc12a9 gene is located on chromosome 5, with a genome length of 19040k...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/90
CPCA01K67/0275C12N15/907C12N9/22A01K2217/075A01K2227/105A01K2267/0375
Inventor 孙维建林以诺吴昊沈贤王文茜郑志强游涛
Owner THE SECOND HOSPITAL AFFILIATED TO WENZHOU MEDICAL COLLEGE