Mouse model for resisting to MLL leukemia by changing epigenetic modification level as well as establishing method and application of mouse model

An epigenetic modification, mouse model technology, applied in the fields of applications, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as no research, and achieve the effect of simple construction method

Pending Publication Date: 2020-05-08
INST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of H3K9me3 mediated by SUV39H1 in the development of MLL leukemia has not been studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mouse model for resisting to MLL leukemia by changing epigenetic modification level as well as establishing method and application of mouse model
  • Mouse model for resisting to MLL leukemia by changing epigenetic modification level as well as establishing method and application of mouse model
  • Mouse model for resisting to MLL leukemia by changing epigenetic modification level as well as establishing method and application of mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The construction of embodiment 1MLL-AF9 leukemia mice

[0043] 1.1 Enrichment of mouse bone marrow c-Kit + cell

[0044] 1) Mice were killed by neck dislocation, sterilized by immersion in 75% ethanol solution, and the bilateral hindlimb bones of the mice were taken using high-pressure sterilized surgical instruments and sterile gauze, and the tibia, femur, and ilium were separated. Use a 1ml syringe to repeatedly flush the marrow cavity from both ends of the bone in 3ml PBE liquid to obtain bone marrow cells.

[0045] 2) The collected bone marrow cells were filtered and centrifuged with a 300-mesh nylon membrane at 1500 rpm at 4° C. for 5 min, and the supernatant was discarded.

[0046] 3) 10 7 Add 20μl CD117 Microbeads to the cells, mix well and let stand on ice for 15min.

[0047] 4) 10 7 Add 1-2ml PBE Buffer to the cells and wash once, centrifuge at 1500rpm, 4°C for 5min, and discard the supernatant.

[0048] 5) 10 8 Cells were resuspended with 500μl PBE Buff...

Embodiment 2

[0064] Example 2 Construction of Highly Expressed Suv39h1 Gene Vector

[0065] 2.1 Primers with EcoRI sites, using mouse bone marrow cDNA as a template to amplify Suv39h1 EcoRI as restriction enzyme sites, the following are the primer sequences used

[0066] Sense 5'CGGAATTC ATGGGGGAGCCGGCGACTCTAGGTTGC 3'

[0067] Anti-sense 5'CGGAATTC CTAGAAGAGGTATTTTCGGCAAGCC 3'

[0068] PCR amplification system

[0069]

[0070] PCR amplification conditions:

[0071] 1. Pre-denaturation: 94°C for 2 minutes

[0072] 2. Denaturation: 94°C for 30s

[0073] 3. Annealing: 30s at 68°C

[0074] 4. Extension: 72°C 40s

[0075] 5. Repeat steps 2-4 for 40 cycles

[0076] 6. Extension: 10min at 72°C

[0077] Run the gel to identify the size of the band, and use the Tiangen gum recovery kit to cut the gel and recover the results. See Figure 2 for the results (sample volume 5 μl, Marker 5 μl, target band 1242bp).

[0078] 2.2 EcoRI digestion of MSCV-IRES-EGFP Vector and PCR amplification pro...

Embodiment 3

[0097] Embodiment 3 packaging virus and concentration

[0098] 3.1 Virus packaging

[0099] 1) 293T cells cryopreserved in liquid nitrogen were resuscitated in a 37°C water bath, and the cells were cultured in a 10cm 2 dish at 37°C, 5% CO 2 cultured in an incubator. The medium was high glucose DMEM+10% FBS. When the 293T cells reach 80-90% confluence, proceed to 1:3 passage.

[0100] 2) Change the fresh medium 8 hours before the plasmid transfection to ensure that 293T is in the logarithmic growth phase before transfection. Transfection was performed when the cells reached more than 90% confluency.

[0101] 3) Prepare plasmid and lipofectamine 2000 mixture (every 10cm 2 Dish)

[0102] i. 15μg plasmid system: suitable for vector fragments > 10kb

[0103] ii. 30μl Lipofectamine2000﹢500μl OPTI-MEM and let stand at room temperature for 5 minutes.

[0104] iii. 15μg plasmid (MA97μg; Pkat 5μg; VSVG 3μg)﹢500μl OPTI-MEM

[0105] Gently mix i and ii and let stand at room temp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mouse model for resisting to MLL leukemia by changing an epigenetic modification level as well as a establishing method and application of the mouse model. A Histone lysine methyltransferase Suv39h1 gene for increasing an H3k9me3 level is introduced to an MLL leukemia cell by utilizing a lentiirus-mediated gene introduction technology, and then, the gene-introduced MLL leukemia cell is transferred to a receptor mouse subjected to half lethal dose irradiation, and thus, the mouse model for resisting to MLL leukemia. The mouse is embodied in significant prolonging of lifetime as well as number reduction and function lowering of leukemia stem cells. The mouse model can be used for simply, rapidly and efficiently realizing qualitative and / or quantitative evaluation ofpotential drugs for treating MLL leukemia.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a mouse model for resisting MLL leukemia by changing the level of epigenetic modification and its construction method and application. Background technique [0002] Since 2010, cancer has become the leading cause of death in China. Among them, leukemia is one of the top ten high-incidence malignant tumors in my country. Epidemiological statistics from 2000 to 2011 showed that the incidence and mortality of male leukemia were on the rise. Leukemia is a malignant disease of the hematopoietic system, characterized by malignant and unlimited proliferation of leukemia cells in the bone marrow and other hematopoietic tissues, infiltrating various tissues and organs throughout the body, and clinical manifestations of fever, bleeding, anemia, hepatosplenomegaly Wait. Leukemia is generally considered to originate from the malignant transformation of a single cell in the body: that is, hema...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A01K67/027C12N15/867C12N15/54
CPCA01K67/0271A01K2207/05A01K2207/12A01K2227/105A01K2267/0381C12N9/1007C12N15/86C12N2740/15043C12N2800/107C12Y201/01043
Inventor初雅婧袁卫平汪晓敏李孟柯
OwnerINST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE