Mouse model for resisting to MLL leukemia by changing epigenetic modification level as well as establishing method and application of mouse model
An epigenetic modification, mouse model technology, applied in the fields of applications, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as no research, and achieve the effect of simple construction method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The construction of embodiment 1MLL-AF9 leukemia mice
[0043] 1.1 Enrichment of mouse bone marrow c-Kit + cell
[0044] 1) Mice were killed by neck dislocation, sterilized by immersion in 75% ethanol solution, and the bilateral hindlimb bones of the mice were taken using high-pressure sterilized surgical instruments and sterile gauze, and the tibia, femur, and ilium were separated. Use a 1ml syringe to repeatedly flush the marrow cavity from both ends of the bone in 3ml PBE liquid to obtain bone marrow cells.
[0045] 2) The collected bone marrow cells were filtered and centrifuged with a 300-mesh nylon membrane at 1500 rpm at 4° C. for 5 min, and the supernatant was discarded.
[0046] 3) 10 7 Add 20μl CD117 Microbeads to the cells, mix well and let stand on ice for 15min.
[0047] 4) 10 7 Add 1-2ml PBE Buffer to the cells and wash once, centrifuge at 1500rpm, 4°C for 5min, and discard the supernatant.
[0048] 5) 10 8 Cells were resuspended with 500μl PBE Buff...
Embodiment 2
[0064] Example 2 Construction of Highly Expressed Suv39h1 Gene Vector
[0065] 2.1 Primers with EcoRI sites, using mouse bone marrow cDNA as a template to amplify Suv39h1 EcoRI as restriction enzyme sites, the following are the primer sequences used
[0066] Sense 5'CGGAATTC ATGGGGGAGCCGGCGACTCTAGGTTGC 3'
[0067] Anti-sense 5'CGGAATTC CTAGAAGAGGTATTTTCGGCAAGCC 3'
[0068] PCR amplification system
[0069]
[0070] PCR amplification conditions:
[0071] 1. Pre-denaturation: 94°C for 2 minutes
[0072] 2. Denaturation: 94°C for 30s
[0073] 3. Annealing: 30s at 68°C
[0074] 4. Extension: 72°C 40s
[0075] 5. Repeat steps 2-4 for 40 cycles
[0076] 6. Extension: 10min at 72°C
[0077] Run the gel to identify the size of the band, and use the Tiangen gum recovery kit to cut the gel and recover the results. See Figure 2 for the results (sample volume 5 μl, Marker 5 μl, target band 1242bp).
[0078] 2.2 EcoRI digestion of MSCV-IRES-EGFP Vector and PCR amplification pro...
Embodiment 3
[0097] Embodiment 3 packaging virus and concentration
[0098] 3.1 Virus packaging
[0099] 1) 293T cells cryopreserved in liquid nitrogen were resuscitated in a 37°C water bath, and the cells were cultured in a 10cm 2 dish at 37°C, 5% CO 2 cultured in an incubator. The medium was high glucose DMEM+10% FBS. When the 293T cells reach 80-90% confluence, proceed to 1:3 passage.
[0100] 2) Change the fresh medium 8 hours before the plasmid transfection to ensure that 293T is in the logarithmic growth phase before transfection. Transfection was performed when the cells reached more than 90% confluency.
[0101] 3) Prepare plasmid and lipofectamine 2000 mixture (every 10cm 2 Dish)
[0102] i. 15μg plasmid system: suitable for vector fragments > 10kb
[0103] ii. 30μl Lipofectamine2000﹢500μl OPTI-MEM and let stand at room temperature for 5 minutes.
[0104] iii. 15μg plasmid (MA97μg; Pkat 5μg; VSVG 3μg)﹢500μl OPTI-MEM
[0105] Gently mix i and ii and let stand at room temp...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap