Method for splitting Cas9 and application

A C-terminal, purpose technology, applied in applications, other methods of inserting foreign genetic materials, botanical equipment and methods, etc., can solve problems such as no longer applicable, reduced splicing efficiency, etc., to achieve the effect of improving editing efficiency

Active Publication Date: 2020-05-08
SUN YAT SEN UNIV
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, after coupling the deaminase module and the efficiency enhancement module to obtain a larger single base editing system, the length of the protein has changed, and the splicing efficiency of some split sites has been greatly reduced due to the excessively long Cas9N or Cas9C. no longer applicable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for splitting Cas9 and application
  • Method for splitting Cas9 and application
  • Method for splitting Cas9 and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1 Construction method of expression vector

[0084] 1) Resolution method of Cas9 protein

[0085] The Cas9 protein is split into two different amino acid sequences Cas9N protein and Cas9C protein at one of the following positions; the Cas9 protein is spCas9 (D10A) protein, and its amino acid sequence is shown in SEQ ID NO. 1, which encodes the nucleus The nucleotide sequence is shown in SEQ ID NO. 2; the split positions are: between positions 178-179, between positions 203-204, between positions 253-254, between positions 309-310, Between 385-386th, 465-466th, 468-469th, 530-531th, 573-574th, 637-638th, 656th -657, 674-675, 684-685, 713-714, 718-719, 729-730, 769-770 Between the 940-941th position, or the 1005-1006th position. The protein groups obtained according to the resolution method are shown in Table 1 below.

[0086] Table 1 Protein groups obtained from different Cas9 split positions

[0087]

[0088]

[0089] 2) Construction of the nucleic acid construct gr...

Embodiment 2

[0099] Example 2 Functional verification of gene editing

[0100] (1) Detect the function of split-Cas9 containing adenosine deaminase-split-ABE system

[0101] According to the method of Example 1, the expression vector group (split-ABE system) containing adenosine deaminase was constructed: pAAV-CAG-ABEN-InteinN and pAAV-CAG-InteinC-ABEC. The expression vector group is that the spCas9 protein is split from one of the following positions: between positions 178-179, between positions 203-204, between positions 253-254, and between positions 309-310 , Between 465-466, between 468-469, between 530-531, between 573-574, between 637-638, between 656-657, between Between 674-675, 684-685, 713-714, 718-719, 729-730; the intein is Npu intein, Mxe intein or Rma intein.

[0102] Constructing HEK293T cells containing m1EmGFP stably expressing, the m1EmGFP is the 70th amino acid codon CAG of the EmGFP sequence mutated to TAG, and the EmGFP nucleotide sequence is shown in SEQ ID NO.16. Becau...

Embodiment 3

[0118] Example 3 Activity detection of gene editing by split-ABE system

[0119] The ability of the split-ABE system to perform genome gene editing was further tested; the expression vector set was the spCas9 protein split from one of the following positions: between positions 203-204, between positions 309-310, and positions Between position 573-574, position 674-675, position 684-685; the intein is Npu intein or Rma intein.

[0120] The gRNA expression vectors pLenti-U6-gRNA-AAVS1, pLenti-U6-gRNA-TERT, and pLenti-U6-gRNA-CCR5 targeting AAVS1, TERT, and CCR5 were constructed according to the method in Example 1. The gRNA sequence of each vector is AAVS1: tccctagtggccccactgtg; TERT: ggtgacaagtgtgatcactt; CCR5: cagccaccctcttttctctg.

[0121] Cultivate HEK293T, HeLa, U2OS to make the cell density about 70%-80%, replace with a new DMEM medium, and divide each cell into an experimental group, a positive control group, and a negative control group (3 multiple wells in each group) , And ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for splitting Cas9 and an application. The present invention provides a method for splitting Cas9 protein at a plurality of sites of the Cas9 protein into different segments of amino acid sequences. The Cas9 protein is spCas9(D10A) protein. The split Cas9 protein can be transported into target cells / vectors more conveniently, and can be recombined by meansof intein. Accordingly, the present invention provides proteome and fusion proteome obtained by the method and nucleic acid constructs and vectors for expressing the fusion proteome, and engineering cells. The fusion proteome and the vectors can be used for editing cytogenes, or in targeted positioning or gene expression transcription activation or gene expression transcription inhibition, and used in preparation of pharmaceutical preparations for gene editing.

Description

Technical field [0001] The invention belongs to the field of biotechnology and relates to a method for splitting Cas9 and its application. Background technique [0002] The rapid development of gene editing technology, especially CRISPR / Cas9 technology, is expected to directly modify the genome sequence for human purposes. Generally speaking, Cas9 cuts double-stranded DNA near the base pair that needs to be repaired, and uses foreign DNA fragments and the repair mechanism in the body to achieve the purpose of gene editing. Connect the effective deaminase module and the efficiency enhancement module to the appropriate position of Cas9 nickase to obtain a single-base editing system, such as a gland obtained by coupling an adenine deaminase and an engineered adenine deaminase Purine base editors (ABE), ABE system can edit AT base pairs into GC base pairs in cells; coupled with cytosine deaminase and 1 or 2 uracil glycosidase inhibition UGI can obtain cytosin base editors (CBE). Th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/113C12N15/864C12N15/90
CPCC12N9/22C12N15/113C12N15/86C12N15/907C12N2310/20C12N2750/14143
Inventor黄军就刘伟亮
OwnerSUN YAT SEN UNIV