A method for nucleic acid aptamer to identify target protein CD63 and its application in overcoming vemurafenib resistance in melanoma

A nucleic acid aptamer and target protein technology, which can be used in anti-tumor drugs, medical preparations containing active ingredients, drug combinations, etc., can solve the problem of unknown application of anti-vemurafenib, and achieve the effect of enhancing sensitivity

Active Publication Date: 2021-09-28
CENT SOUTH UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the specific function of CD63 in the production of vemurafenib in melanoma is still controversial, and its application in anti-vemurafenib is unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for nucleic acid aptamer to identify target protein CD63 and its application in overcoming vemurafenib resistance in melanoma
  • A method for nucleic acid aptamer to identify target protein CD63 and its application in overcoming vemurafenib resistance in melanoma
  • A method for nucleic acid aptamer to identify target protein CD63 and its application in overcoming vemurafenib resistance in melanoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Target type identification of nucleic acid aptamer LL4A

[0056] The experimental steps are as follows:

[0057] (1) Preparation of ssDNA: Take 50μM nucleic acid aptamer LL4A and library (Library), denature at 95°C for 5min, refold on ice for 10min, centrifuge at 5000rpm at 4°C for 3min, add Binding buffer to make the DNA concentration 250nM, place on ice stand-by.

[0058] ssDNA sequence (LL4A):

[0059] GCTGGACTCACCTCGACCAGAGCCATTGGGTTTCCTAGGAAATAGGGCCTTTACTATGAGCGAGCCTGGCG;

[0060] (2) Cell preparation: culture Mel28-PLX cells in four dishes to the logarithmic growth phase, wash twice with 2mL DPBS, add 200μl 0.25% trypsin and 200μl 0.1mg / ml proteinase K to two of the dishes to digest at room temperature for 10min , the other two dishes were digested with 0.2% EDTA under the same conditions, and then 500 μl of complete medium was added to terminate the digestion, centrifuged at 800 rpm for 4 min, and the supernatant was discarded. Wash twice with Wash...

Embodiment 2

[0062] Example 2: Nucleic acid aptamer target mass spectrometric identification

[0063] 1) Extraction of cell membrane proteins

[0064] (1) Inoculate Mel28-PLX cells in 10 10cm culture dishes and culture them to the logarithmic phase;

[0065] (2) Discard the old culture medium and wash it twice with DPBS;

[0066] (3) After digestion with enzyme-free digestion solution, collect the cells in a 15mL centrifuge tube with DPBS;

[0067] (4) Centrifuge and wash with Washingbuffer, discard the supernatant;

[0068] (5) Add a corresponding amount of hypotonic buffer (300 μL / dish) into a 15 mL centrifuge tube, vortex and mix well, and shake at 4° C. for 30 min. 4000rpm, centrifuge for 10min and discard the supernatant. Then wash with hypotonic buffer 3 times;

[0069] (6) Add a corresponding amount of membrane protein lysate (200 μL / dish) to the centrifuge tube, shake and mix well, lyse at 4°C for 30 minutes, centrifuge to retain the supernatant, 4000 rpm, 4°C, 10 minutes. Th...

Embodiment 3

[0086] Example 3: Co-localization of LL4A and CD63 proteins

[0087] Laser confocal fluorescence microscopy can visually display the fluorescent signals on the cell surface. In this experiment, the colocalization experiment of nucleic acid aptamer and CD63 protein was carried out by laser confocal fluorescence microscopy, which further proved that the target of LL4A is CD63 protein.

[0088] The specific experimental steps are as follows:

[0089](1) Cell preparation: Mel28-PLX cells were connected to the optical culture dish 24 hours in advance, so that the confluence of the cells reached 90%-95% when used, washed three times with Washing buffer, blocked with 1% BSA for 30 minutes, and aspirated after sealing. abandoned.

[0090] (2) Preparation of LL4A and antibody: 10 μL of FITC-labeled CD63 antibody and 50 pmol of LL4A labeled with Cy5 fluorophore at the 5′ end were added to a 1.5 mL EP tube containing 200 μL of Bindingbuffer.

[0091] (3) Incubation of cells with LL4A a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for using nucleic acid aptamer LL4A to recognize target protein CD63. The invention also includes the application of the nucleic acid aptamer LL4A in the preparation of a reagent for recognizing the target protein CD63, and a drug for improving the sensitivity of melanoma cells to vemurafenib. The present invention has confirmed through research that the nucleic acid aptamer LL4A can specifically recognize the target protein CD63, and it is found that the expression of the target protein CD63 is correlated with the sensitivity of drug-resistant melanoma to vemurafenib, and can be achieved by knocking down the target protein CD63 Expression improves sensitivity.

Description

technical field [0001] The invention relates to a method for identifying target protein CD63 by using a nucleic acid aptamer, and an application of a nucleic acid aptamer combined with a target protein CD63 in identifying vemurafenib-resistant melanoma and overcoming vemurafenib resistance. Background technique [0002] Melanoma is the most malignant and fatal type of all skin cancers, and it is the main cause of death for most skin cancer patients. The early stages of melanoma can be cured by surgical resection, but there are still some patients with metastatic disease, the prognosis is very poor, and the 5-year survival rate is about 6%. For metastatic melanoma, medical-based treatment strategies are generally adopted, including immunotherapy and targeted therapy, among which the MAPK / ERK pathway (composed of protein kinases such as RAS→RAF→MEK→ERK) is the most common one in melanoma. Mutation pathway (over 80%), approximately 50% of melanoma patients have BRAF mutations,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/574G01N33/68A61K45/00A61P35/00
CPCA61K45/00A61P35/00G01N33/5743G01N33/57492G01N33/68G01N2333/70596
Inventor刘静荔辉刘鹃王梓刘凤萧小鹃
OwnerCENT SOUTH UNIV