Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer set, kit and detection method for rapid detection of carbapenemase genes

A carbapenemase and primer set technology, applied in biochemical equipment and methods, recombinant DNA technology, resistance to vector-borne diseases, etc., can solve the problem of not detecting genes at the same time, and shorten the detection time and save the detection. Cost and effect of fully closed reaction process

Pending Publication Date: 2020-07-24
GENERAL HOSPITAL OF NUCLEAR IND
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no kit for the direct detection of carbapenemase using molecular beacon technology, especially no kit that can simultaneously detect genes KPC, NDM, OXA48, VIM and IMP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set, kit and detection method for rapid detection of carbapenemase genes
  • Primer set, kit and detection method for rapid detection of carbapenemase genes
  • Primer set, kit and detection method for rapid detection of carbapenemase genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Composition and detection method of a kit for rapidly detecting carbapenemase gene

[0049] 1. The composition of the kit

[0050] (1) Primer set: amplification primer pairs and molecular beacon probes for detecting Enterobacteriaceae carbapenemase resistance genes KPC, NDM, OXA48, VIM and IMP;

[0051] Wherein, the primer set of KPC gene is:

[0052] KPC-F (SEQ ID NO: 1): CAGCTCATTCAAGGGCTTTC;

[0053] KPC-R (SEQ ID NO: 2): CGTCATGCCTGTTGTCAGAT;

[0054] Molecular beacon probe KPC-probe (SEQ ID NO: 3): cgcgaACACACCCATCCGTTACGGCA tcgcg;

[0055] The primer set for the NDM gene is:

[0056] NDM-F (SEQ ID NO: 4): ATATCACCGTTGGGATCGAC;

[0057] NDM-R (SEQ ID NO: 5): TAGTGCTCAGTGTCGGCATC;

[0058] Molecular beacon probe NDM-probe (SEQ ID NO: 6): cgcgaGCCTGATCAAGGACAGCAAGG tcgcg;

[0059] The primer set for the OXA48 gene is:

[0060] OXA48-F (SEQ ID NO: 7): GTGGCATCGATTATCGGAAT;

[0061] OXA48-R (SEQ ID NO: 8): AGAGCACAACTACGCCCTGT;

[0062] Molecular beacon probe...

Embodiment 2

[0082] Utilize the method for rapid detection carbapenemase gene of the kit described in embodiment 1

[0083] 1. Sample

[0084] The CRE strains of ST11 Klebsiella pneumoniae isolated from clinical samples were randomly collected, and then the isolated CRE strains were cultured at 37°C for 24 hours, and then the DNA was extracted using the method described in Example 1. Five common Enterobacteriaceae carbapenemase drug-resistant gene KPC, NDM, OXA48, VIM and IMP specific primers, the corresponding positive samples were screened by PCR and identified by sequencing, and then a single carbapenemase drug-resistant gene KPC, DNA samples of NDM, OXA48, VIM and IMP were mixed to make DNA samples containing five common Enterobacteriaceae carbapenemase resistance genes KPC, NDM, OXA48, VIM and IMP. The clinical sample used in this embodiment is a blood sample, but it is not limited thereto. In addition, respiratory samples such as urine and sputum containing the CRE strain of Klebsie...

Embodiment 3

[0090] Sensitivity Analysis of Isothermal Amplification Melting Curve Detection Kit Based on Molecular Beacon Technology for CRE Strains Isolated from Clinical Samples

[0091] 1. Method

[0092] Sample processing: The CRE strain of ST11 Klebsiella pneumoniae isolated from clinical samples was adjusted to 1.8×10 with normal saline. 8 CFU / mL, then carry out gradient dilution (100 μL bacterial solution + 900 μL normal saline for dilution), then centrifuge at 10,000 rpm for a short time, discard the supernatant, then crush it on a shaker for 10 minutes, take 300 μL of the supernatant and add into a 96-deep-well plate, extract DNA on a nucleic acid extractor, and use 1.5×10 7 CFU / mL-1.5×10 2 The DNA extracted from the CFU / mL bacterial solution was used as a template, and 5 μL of each concentration gradient was amplified.

[0093] 2. Use the detection method described in Example 1 to detect. After the reaction is completed, observe the peak Tm value of the melting curve, and an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer set, kit and detection method for rapid detection of carbapenemase genes. The primer set includes amplification primer pairs and molecular beacon probes for detectingenterobacter carbapenemase drug resistance genes KPC, NDM, OXA48, VIM and IMP, and nucleotide sequences are as shown in SEQ ID NO: 1-SEQ ID NO: 15. The kit disclosed in the invention only needs one sample addition, one reaction tube and one reaction system to complete the detection of the five common carbapenemase drug resistance genes of enterobacter within 2 h, has the advantages such as rapidity, high-efficiency and accuracy, greatly shortens detection time, saves detection cost, and improves detection efficiency. Moreover, compared with the existing probe method multiple PCR, the kit reduces primer design and interference between primers, and thereby can reduce the occurrence of false positives / false negatives.

Description

technical field [0001] The invention relates to the technical field of nucleic acid detection, in particular to a primer set, a kit and a detection method for rapidly detecting carbapenemase genes. Background technique [0002] Bacterial drug resistance has become a global concern, and infection caused by drug-resistant bacteria has become a new challenge for clinical anti-infective treatment and a major threat to human health and life. Enterobacteriaceae bacteria are widely distributed and closely related to humans, and Enterobacteriaceae are important nosocomial infection bacteria. Carbapenem antibiotics are the main antibiotics for the treatment of Enterobacteriaceae infection. The extensive use of the drug, carbapenem-resistant Enterobacteriaceae (Carbapenem resistant Enterobacteriaceae, CRE) appeared clinically. At present, the common carbapenemase resistance genes in clinic mainly include KPC, NDM, OXA48, VIM and IMP. Although there are related kits for the detection...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6851C12N15/11
CPCC12Q1/689C12Q1/6851C12Q2600/106C12Q2600/16C12Q2531/113C12Q2537/143C12Q2563/107Y02A50/30
Inventor 杜鸿张海方张碧颖朱志宸闻奕丞
Owner GENERAL HOSPITAL OF NUCLEAR IND