Bacillus and method for synthesizing nano-selenium by using same
A Bacillus, nano-selenium technology, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The acquisition of the bacillus strain SL of the present invention: In 2018, the soil sample of the selenium-enriched tea factory in Kaiyang County, Guizhou Province was passed through the plate dilution coating method for 7 times, and the sample was coated on the LB medium (NaCl10g / L, tryptone 10g / L, yeast powder 5g / L, deionized water), 30±0.5℃, 150±5r / min to obtain the bacterial liquid. The cell morphology of strain SL was rod-shaped with a size of 3-5 μm. Such as figure 1 Shown, the scanning electron micrograph of the Bacillus strain SL.
[0035] The Bacillus strain was preserved on November 28, 2019 in the General Microbiology Center of the China Committee for the Preservation of Microorganisms (No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101), and its preservation number For: CGMCCNo.19051.
Embodiment 2
[0036] Embodiment 2: the 16SrRNA gene molecular identification of described bacillus bacterial strain
[0037] The genomic DNA of Bacillus SL was extracted, the 16SrRNA gene sequence was amplified by PCR, and the sequence homology was compared using BLAST program, and the most similar genus was Bacillus. It was determined that SL was Bacillus. Such as figure 2 As shown, the phylogenetic tree of the strain 16SrRNA gene, the 16SrRNA gene sequence of the SL strain is as follows:
[0038] GGCTCAGGATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGC GAATGGATTAAGAGCTTGCTCTTATGAAGTTAGCGGCGGACGGGTGAGTAA CACGTGGGTAACCTGCCCATAAGACTGGGATAACTCCGGGAAACCGGGGC TAATACCGGATAACATTTTGAACCGCATGGTTCGAAATTGAAAGGCGGCTT CGGCTGTCACTTATGGATGGACCCGCGTCGCATTAGCTAGTTGGTGAGGTA ACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCC ACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGG GAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGA TGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTAGGGAAGAACAAGTGCTA GTTGAATAAGCTGGCACCTTGACGGTACCTAACCAGAAAGCCA...
Embodiment 3
[0039] Embodiment 3: the growth curve of described bacillus bacterial strain SL in LB medium
[0040] Using the bacterial solution in Example 1, adopt LB medium (NaCl10g / L, tryptone 10g / L, yeast powder 5g / L, deionized water, pH6.0) sterilized under high pressure at 121°C for 20min, 30 ± 0.5 Cultivate at 150±5r / min, and the inoculum amount is 2% (V / V). Such as image 3 Shown, the growth situation of described bacillus strain SL, bacterial strain grows 10±1h and enters stationary phase, and 2-8h is logarithmic growth phase.
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
| particle size | aaaaa | aaaaa |
| particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


