Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus and method for synthesizing nano-selenium by using same

A Bacillus, nano-selenium technology, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc.

Active Publication Date: 2020-08-07
DALIAN UNIV OF TECH
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of the strains found so far can only reduce SeO at low concentrations. 3 2- , for the reduction of SeO under high concentration conditions 3 2- strains to be further developed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus and method for synthesizing nano-selenium by using same
  • Bacillus and method for synthesizing nano-selenium by using same
  • Bacillus and method for synthesizing nano-selenium by using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The acquisition of the bacillus strain SL of the present invention: In 2018, the soil sample of the selenium-enriched tea factory in Kaiyang County, Guizhou Province was passed through the plate dilution coating method for 7 times, and the sample was coated on the LB medium (NaCl10g / L, tryptone 10g / L, yeast powder 5g / L, deionized water), 30±0.5℃, 150±5r / min to obtain the bacterial liquid. The cell morphology of strain SL was rod-shaped with a size of 3-5 μm. Such as figure 1 Shown, the scanning electron micrograph of the Bacillus strain SL.

[0035] The Bacillus strain was preserved on November 28, 2019 in the General Microbiology Center of the China Committee for the Preservation of Microorganisms (No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101), and its preservation number For: CGMCCNo.19051.

Embodiment 2

[0036] Embodiment 2: the 16SrRNA gene molecular identification of described bacillus bacterial strain

[0037] The genomic DNA of Bacillus SL was extracted, the 16SrRNA gene sequence was amplified by PCR, and the sequence homology was compared using BLAST program, and the most similar genus was Bacillus. It was determined that SL was Bacillus. Such as figure 2 As shown, the phylogenetic tree of the strain 16SrRNA gene, the 16SrRNA gene sequence of the SL strain is as follows:

[0038] GGCTCAGGATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGC GAATGGATTAAGAGCTTGCTCTTATGAAGTTAGCGGCGGACGGGTGAGTAA CACGTGGGTAACCTGCCCATAAGACTGGGATAACTCCGGGAAACCGGGGC TAATACCGGATAACATTTTGAACCGCATGGTTCGAAATTGAAAGGCGGCTT CGGCTGTCACTTATGGATGGACCCGCGTCGCATTAGCTAGTTGGTGAGGTA ACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCC ACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGG GAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGA TGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTAGGGAAGAACAAGTGCTA GTTGAATAAGCTGGCACCTTGACGGTACCTAACCAGAAAGCCA...

Embodiment 3

[0039] Embodiment 3: the growth curve of described bacillus bacterial strain SL in LB medium

[0040] Using the bacterial solution in Example 1, adopt LB medium (NaCl10g / L, tryptone 10g / L, yeast powder 5g / L, deionized water, pH6.0) sterilized under high pressure at 121°C for 20min, 30 ± 0.5 Cultivate at 150±5r / min, and the inoculum amount is 2% (V / V). Such as image 3 Shown, the growth situation of described bacillus strain SL, bacterial strain grows 10±1h and enters stationary phase, and 2-8h is logarithmic growth phase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
particle sizeaaaaaaaaaa
particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a bacillus. According to the bacillus, a soil sample of a selenium-enriched tea factory in Kaiyang county of Guizhou province is subjected to seven times of plate dilution coating in 2018 and the soil sample is coated on an LB culture medium and culturing is carried out at the temperature of 30 + / -0.5 DEG C and the speed of 150 + / -5 r / min to obtain a bacterial solution. Thecell morphology of the strain of the bacillus is rod-shaped, and the size of the strain is 3-5microns; the bacillus belongs to gram-positive bacteria, the thallus is rod-shaped, and the Genbank loginnumber of the 16SrRNA gene sequence of the bacillus is MN371282. The bacillus disclosed by the invention can tolerate SeO3 <2-> with relatively high concentration and has the capability of reducing the SeO3 <2-> into elemental nano-selenium particles with different particle sizes.

Description

technical field [0001] The invention relates to the technical field of microorganism cultivation and application, and more specifically relates to a bacillus and a method for synthesizing nano selenium. Background technique [0002] Selenium is an essential trace element for organisms. Studies have shown that it plays a non-negligible role in the metabolism of microorganisms, the growth and development of animals and plants, and even the health of human beings themselves. In nature, element selenium usually exists in two forms: organic selenium and inorganic selenium. Organic selenium usually exists in organisms in the form of selenoamino acids and participates in various life activities in organisms; inorganic selenium usually exists in the form of selenate ( Four forms of VI), selenite (IV), elemental selenium (0) and metal selenium compounds (-II) exist in environmental media such as rocks, soils, natural water bodies, and selenium-containing wastewater. However, selenat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12P3/00C12R1/07
CPCC12P3/00C12R2001/07C12N1/205
Inventor 曲媛媛范书伶张珩琳杨颖李政杨婧李严
Owner DALIAN UNIV OF TECH