Application of ASGR1 mutant gene in preparation of humanoid low-blood-fat metabolic animal model

A technique of mutating genes and animal models, applied in the field of genetic engineering, can solve the problems of high cost of animal preparation, difficulty in surviving, and high cost of antibodies

Active Publication Date: 2020-09-01
成都中科奥格生物科技有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In short, genetic engineering and drug induction are the most likely model technologies to achieve hypolipidemia. However, genetically engineered animals are expensive to prepare, more difficult to survive than ordinary animals, and cannot form an effective breeding population; drug induction has effective verification and high antibody costs. , The effect of drug administration is inconsistent due to individual differences in animal phenotypes, which limits its development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ASGR1 mutant gene in preparation of humanoid low-blood-fat metabolic animal model
  • Application of ASGR1 mutant gene in preparation of humanoid low-blood-fat metabolic animal model
  • Application of ASGR1 mutant gene in preparation of humanoid low-blood-fat metabolic animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the preparation of ASGR1 gene knockout piglet

[0042] According to the pig (Sus scrofa) asialoglycoprotein receptor 1 (asialoglycoprotein receptor, ASGR1) gene sequence (Gene ID: NC_010454.4), using single-stranded guide RNA (single guide RNA, sgRNA) online design website (http: / / crispr.mit.edu / ) in its 5th exon ( figure 1 ) designed and synthesized sgRNA (sgRNA:agcagtttgtgtccgacctgcgg) that specifically recognizes the target sequence DNA. After the synthesized sgRNA oligonucleotides were annealed (94°C, 10min; 37°C, 10min), they were ligated into the PX330 expression vector recovered by digestion with BbsI to construct the sgRNA expression vector ( figure 2 ). After the constructed expression vector was sequenced to verify that the connection was correct, the plasmid was extracted for cell transfection.

[0043] The verified effective sgRNA expression vector and Enhanced Green Fluorescent Protein (Enhanced Green Fluorescent Protein, EGFP) plasmid we...

Embodiment 2

[0053] Example 2. Comparison of the similarity between the hypolipidemia phenotype of the ASGR1 gene knockout animal model and the ASGR1 mutant population

[0054] The ASGR1 knockout pigs obtained in Example 1 were tested for blood lipid indexes.

[0055] 1. Experimental animals

[0056] Experimental group 1: ASGR1-KO 3 heads (prepared in Example 1)

[0057] Experimental group 2: ASGR1-SKO pigs (individuals produced by breeding ASGR1-KO pigs with WT sows)

[0058] Control group: wild-type pigs (wide type, WT) without gene editing were used as controls.

[0059] All experimental animals were fed under the same experimental conditions.

[0060] 2. Test method:

[0061] At the same month age (17 months), fasting blood was collected from animals in the three groups, serum was separated, and blood lipid indicators (blood total cholesterol TC, triglyceride TG, LDL-c, HDL-c, Non-HDL-c, apoA1, apoB, etc.)

[0062] 3. Test results:

[0063] For ASGR1 knockout pigs (ASGR1-KO (ASG...

Embodiment 3

[0065] Example 3. Resistance of ASGR1 knockout animal model to high-fat and high-glucose-induced atherosclerosis

[0066] In the present invention, the tolerance experiment of atherosclerosis is carried out on the ASGR1 knockout pig and the control group.

[0067] A high-fat and high-cholesterol diet (20% fat, 2% cholesterol) was used to induce ASGR1 knockout pigs to model atherosclerosis with the control group. At the same time, a blank control group fed normal diet was set up to speed up the experimental process. The ASGR1 knockout pigs were fed for 6 months with a high-fat and high-cholesterol diet, and the high-fat and high-cholesterol diet and normal feed formulations are shown in Table 3.

[0068] Table 3 Test pig feed formula (%)

[0069] raw material name normal feed High Fat and High Cholesterol Feed corn 80.2 61.8 soybean meal 12 9.2 rice bran 6 4.7 fish meal 0.3 0.3 stone powder 0.72 0.7 salt 0.28 0.3 but...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and discloses application of an ASGR1 mutant gene in the preparation of a humanoid low-blood-fat metabolic animal model. Gene editingis performed on the suitable editing sites of an ASGR1 gene sequence, the obtained animal has a significant tolerance effect on a high fat and high sugar diet (the main inducement of atherosclerosis),and can be adopted as a model for the prevention of human atherosclerosis diseases; natural breeding can be performed to establish a stable breeding group, and the large-scale preparation requirementof the gene mutation model can be met. The invention further discloses a method for preparing the humanoid low-blood-fat metabolic animal model on a large scale.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the application of ASGR1 mutant gene in the preparation of anthropomorphic animal models of hypolipidemia. Background technique [0002] Animal disease models refer to animals with simulated performance of human diseases established in various medical scientific researches. It is mainly used in the research of experimental physiology, experimental pathology and experimental therapeutics (including new drug screening). The development of human diseases is very complicated. Using humans as experimental objects to deeply explore the mechanism of disease occurrence and promote the development of medicine has come slowly. The accumulated clinical experience is not only limited in time and space, but also many experiments are morally unreasonable. and methods are also limited. With the help of indirect research on animal models, factors that are impossible or ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113C12N15/87C12N15/90A01K67/027
CPCC07K14/7056C12N15/113C12N15/8778C12N15/907A01K67/0276C12N2310/20A01K2207/15A01K2217/075A01K2227/108A01K2267/0362
Inventor潘登科邢向阳
Owner成都中科奥格生物科技有限公司