Tobacco terpenoid synthase nttps7 gene and its vector and application
A technology of terpene synthase and tobacco, applied in the field of molecular biology, can solve the problem of unclear leaf color
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Cloning and sequence analysis of tobacco terpenoid synthase gene NtTPS7
[0024] The inventors obtained the tobacco terpenoid synthase gene NtTPS7 based on the sequencing of the tobacco whole genome and a large number of bioinformatics analysis and screening; then, the tobacco terpenoid synthase gene NtTPS7 was cloned using the tobacco LT1534 whole genome cDNA as a template, specifically:
[0025] 1. cDNA template preparation
[0026] Total RNA was extracted from fresh tissues of tobacco plants using reagents (Invitrogen, USA) according to the manufacturer's instructions. use One-Step gDNA Removal and cDNA Synthesis SuperMix (Quanshijin, China) reverse-transcribes total RNA into cDNA.
[0027] 2. PCR product amplification and recovery
[0028] Primers were designed with Primer5, and the primer sequences were as follows:
[0029] CDS-F: 5'-ATGGGAAGTTTCAGGAGATGCATGGAAATT-3' (shown in SEQ ID NO: 3)
[0030] CDS-R: 5'-CTAGTTGTCAACAACCTCAATCAAGCTTG-3' (shown...
Embodiment 2
[0041] Example 2: Analysis of the expression pattern characteristics of tobacco NtTPS7 gene in different tissues
[0042] The expression patterns of NtTPS7 gene in different tobacco tissues (root, stem, leaf, flower) were detected by fluorescence quantitative qRT-PCR method. FastStart Universal SYBR Green Master (ROX) Realtime kit (Roche) was used. The relative quantitative method was selected, and the tobacco EF1α gene was used as the internal reference gene (the qRT-PCR primer sequences of the internal reference gene were shown in SEQ ID NO: 10 and SEQ ID NO: 11), and the template was the cDNA obtained under the above-mentioned different tissues, and each sample was Three replicates were set, and negative control and positive pair were set at the same time, and the reaction system was shown in Table 1;
[0043] Table 1
[0044]
[0045] qRT-PCR primer sequences:
[0046] NtTPS7-qRT-F: 5'-AGCCCATTCATACAAATCTACC-3' is shown in SEQ ID NO:8;
[0047]NtTPS7-qRT-R: 5'-CAAGA...
Embodiment 3
[0052] Example 3: Construction of gene editing vector
[0053] Using CRISPR / Cas9 gene editing technology to design the target site of tobacco NtTPS7 gene to construct NtTPS7 gene knockout vector; genetically transform tobacco varieties to obtain transgenic tobacco plants;
[0054] 1. Design target sites:
[0055] Target: ACAAAGGCATTACATGTCTT (as shown in SEQ ID NO: 5)
[0056] Synthetic plus linker sequence
[0057] Target-F: GATTgACAAAGGCATTACATGTCTT (as shown in SEQ ID NO:6)
[0058] Target-R: aaacAAGACATGTAATGCCTTTGTc (as shown in SEQ ID NO: 7)
[0059] 2. Knockout vector construction
[0060] ① Single-stranded oligo DNA annealing to form double-stranded DNA
[0061] The synthesized 2 single-stranded primers (Target-F and Target-R) were diluted to 50 μM, and then annealed. The annealing reaction system is shown in Table 2;
[0062] Table 2
[0063]
[0064]
[0065] Incubate the reaction system at 95°C for 3 min in a PCR machine, and cool to room temperature na...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More