Exosome coupled with coronavirus S protein on surface and preparation method for exosome and application of exosome
An exosome and protein technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and applications, to achieve good antigen presentation effect, good clinical application, and the effect of avoiding infection
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2020-09-11
- Estimated Expiration
- Not applicable · inactive patent
Smart Images

Figure 1 
Figure 2
Abstract
Description
technical field
[0001] The invention belongs to the technical field of biopharmaceuticals, and in particular relates to a surface-coupled S protein exosome and its preparation method and application. Background technique
[0002] At present, there is no confirmed effective anti-disease treatment for the treatment of new coronary pneumonia clinically. Alpha-interferon, protease inhibitors or nucleotide ribavirin can be used, but the above treatment strategies have certain limitations, except for pregnant women. In addition to being used with caution by children and the elderly, patients who are allergic to interferon and excipients, patients with immune diseases, patients with heart, liver disease, renal insufficiency or bone marrow dysfunction, and patients with epilepsy and central nervous system function Injuries are not applicable. Therefore, the task of developing new drugs for the treatment of new coronavirus is very urgent. Contents of the invention
[0003] In v...
Examples
preparation example Construction
[0023] The present invention provides a method for preparing exosomes with surface-coupled S protein, comprising the following steps:
[0024] 1) Insert the DNA fragment shown in SEQ ID No.1 into the pWPI vector after digestion with Pme1 to form the recombinant vector pWPI-S-RBD-SD-CP05;
[0025] 2) co-transfect eukaryotic cells with the recombinant vector pWPI-S-RBD-SD-CP05 and psPAX2, pMD2.G, and package them into lentivirus;
[0026] 3) After the eukaryotic cells are infected with the lentivirus, the green fluorescent protein-positive cells are screened to continue culturing to establish a stable transfected cell line;
[0027] 4) Cultivate the stable transfected cell line, lyse the cells, and separate the protein lysate containing CP05-S protein;
[0028] 5) Mixing and incubating the protein lysate containing CP05-S protein with human plasma, extracting exosomes, and obtaining exosomes with surface-coupled S protein.
[0029] In the present invention, the DNA fragment sh...
Embodiment 1
[0044] (1) Human cells express CP05-S protein:
[0045] The specific method is as follows: the nucleotide sequence shown in the following SEQ ID No.1 is synthesized by a gene synthesis company, and then inserted into the pWPI vector using the Pme1 restriction site, and the constructed vector is pWPI-S-RBD-SD-CP05, wherein The CP05 sequence is shown in SEQ ID No.2 (tgcaggcatagccagatgac ggtgacaagcaggct); then the recombinant vector pWPI-S-RBD-SD-CP05 and psPAX2, pMD2.G are co-transfected into 293 cells and packaged into lentivirus; the obtained lentivirus infection For 293 cells, the green fluorescent protein-positive cells were screened by flow cytometry and continued to be cultured to establish a stable transfected cell line for future use.
[0046] (2) Extraction of protein containing CP05-S
[0047] The above stable cell line was cultured with a medium containing 10% serum replacement, and then directly centrifuged at 10000 g for 5 min to remove cell debris, and the superna...
Embodiment 2
[0053] The exosomes of PBS, naked S protein, and surface-coupled S protein prepared in Example 1 were used to immunize mice, specifically, 200 micrograms (protein concentration) of exosomes were injected intraperitoneally, once a week, twice consecutively, Three weeks after the immunization, blood was collected to prepare antiserum, and the antiserum was subjected to antibody titer detection. The specific method was as follows:
[0054] Firstly, the purified extracellular region of S protein (purchased from GenScript and other commercialized antigens) was used as the antigen, and the antigen coating solution (50mM carbonate coating buffer, pH 9.6) was used; the formula was NaHCO 3 1.59g, NaHCO 3 2.93g with distilled water to 1000ml) diluted to 5μg / mL, then add 100μL to each well of a 96-well plate, and coat at 4°C overnight to make the extracellular region of S protein attached to the plate. The next day, discard the coating solution, add 200 μL of 5% BSA to block, incubate ...