Aspergillus niger Rha-N1 and application thereof

A technology of rha-n1 and Aspergillus niger, which is applied in the fields of genetic engineering and biomedicine, can solve the problems of difficulty in achieving purity, difficulty in separating other enzyme components, low expression level, etc., and achieves environmental protection, mild reaction conditions, and operation. simple steps

Inactive Publication Date: 2020-09-15
ZHEJIANG UNIV OF TECH
View PDF32 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Wild-type Aspergillus niger can secrete α-L-rhamnosidase, but the expression level is low, and it often exists in the form of a complex enzyme, which is difficult to separate from other enzyme components and cannot meet the needs of flavone monoglycoside production
With the application of α-L-rhamnosidase more and more widely, the traditional fermentation production method can no longer meet the demand, and it is difficult to achieve high purity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus niger Rha-N1 and application thereof
  • Aspergillus niger Rha-N1 and application thereof
  • Aspergillus niger Rha-N1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 α-L-rhamnosidase gene synthesis and recombinant plasmid construction

[0045] The α-L-rhamnosidase gene (GenBank: XP_001389086.1) from Aspergillus niger searched by NCBI was synthesized by Qingke Company. The final gene sequence is shown in SEQ ID NO.2, encoding The amino acid sequence is shown in SEQ ID NO.1.

[0046] Primer pairs designed to amplify the α-L-rhamnosidase gene sequence with homology arms,

[0047] N1-S: CCGCTTGAGCAGACATCACAATGTGGTCTTCCTGGCTGCTGTC

[0048] N1-N: GGCTTTCGCCACGGAGCTCTAGTGGTGGTGGTGGTGGTGATTAT

[0049] Using the synthetic sequence of SEQ ID NO.2 as a template, PCR amplification was performed with the primer pair (N1-S and N1-N), and Primer Star MasterMix (Takara Company) high-fidelity enzyme was selected for pre-denaturation at 98°C for 3 minutes ; Amplification stage 30 cycles, according to 98 ℃, 10s, 55 ℃, 5s, 72 ℃, 15s; extension 72 ℃, 10min. The PCR product was digested and purified to obtain a purified fragment (the target...

Embodiment 2

[0055] Embodiment 2 Agrobacterium Transformation

[0056] Take out Agrobacterium tumefaciens competent cells AGL-1 from the -80°C refrigerator, thaw in an ice bath, add 10 μl of the recombinant plasmid prepared in Example 1, bathe in ice for 5 minutes, freeze in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and store on ice. After bathing for 5 minutes, add 1mL LB liquid medium, incubate at 28°C for 2h, spread on LB solid plates containing 50μg / mL kanamycin and 50μg / mL rifampicin, and incubate at 28°C for 2d.

[0057] Pick out a single colony that grows well on the plate, and suspend it in 10 μL ddH 2 O made bacterial suspension, boiled water bath 10min, cooled to room temperature, used it as a template, identified positive clones by colony PCR method, and designed primer pairs for verifying the target gene,

[0058] YZ-S: CCCGCTTGAGCAGACATCAC

[0059] YZ-N: CCGTCATGATACGGGCTCAC

[0060] The bacterial suspension was used as a template, and the primer pair...

Embodiment 3

[0061] Embodiment 3 Agrobacterium-mediated transformation of Aspergillus niger

[0062] (1) Aspergillus niger host bacteria (purchased from Yiyuan Kangyuan Biotechnology Co., Ltd., product number 3.350) were inoculated into PDA slant medium, and cultured at 30°C for 5 days. Wash the spores from the slope with 10 mL of sterile water and filter with two layers of sterile lens tissue to obtain a spore suspension. Measure the spore concentration with a cytometer and dilute it to 10 7 individuals / mL to obtain a suspension of Aspergillus niger spores for Agrobacterium transformation.

[0063] (2) Pick a single colony of Agrobacterium that has been transferred to the recombinant plasmid from the LB plate of Example 2, and inoculate it into the LB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL rifampin, at 28° C. , shake culture at 200rpm for 24h; centrifuge the culture solution, and dilute the bacteria to OD with AIM liquid medium 600 About 0.4, 28°C, 200rpm continue to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses aspergillus niger Rha-N1 and an application thereof. An alpha-L-rhamnosidase gene is connected to a pCAMBIA vector to obtain a recombinant plasmid, agrobacterium tumefaciens isintroduced, fermentation expression is performed after aspergillus niger is subjected to agrobacterium tumefaciens mediated transformation, and the enzyme activity of an obtained recombinase is 0.471U / mL. Normal-temperature plasma mutagenesis is performed to obtain a mutant strain with the fermentation broth enzyme activity of 0.652 U / mL. The recombinant aspergillus niger can be applied to hydrolysis of rutin, hesperidin and naringin, finally a substrate is completely converted, and isoquercetin, hesperetin monoglucoside and prunin with the purity larger than 98% are obtained.

Description

[0001] (1) Technical field [0002] The invention relates to a recombinant Aspergillus niger expressing α-L-rhamnosidase and its application, belonging to the technical fields of genetic engineering and biomedicine. [0003] (2) Background technology [0004] α-L-rhamnosidase (α-l-rhamnosidase, E.C.3.2.1.40), mostly belonging to glucosidehydrolase family 78 (GH78), this enzyme can specifically hydrolyze substances containing α-L-rhamnose at the end, such as flavonoids naringin, hesperidin, rutin; saikosaponin, ginsenoside, etc. α-L-rhamnosidase is a glycoside hydrolase with a wide range of sources, which is ubiquitous in animal and plant tissues, bacteria, and fungi. The α-L-rhamnosidase derived from microorganisms is the most extensive. Among them, the α-L-rhamnosidase derived from bacteria can be used to hydrolyze flavonoid glycosides that widely exist in nature. The common ones are Lactobacillus, Bacillus Bacillus and other bacteria; fungal α-L-rhamnosidase was first found...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N15/56C12N15/80C12N13/00C12P19/60C12R1/685
CPCC12N9/2402C12N15/80C12N13/00C12P19/60C12Y302/0104
Inventor郑建永李露园汪钊章银军袁围肖延铭
OwnerZHEJIANG UNIV OF TECH