Supercharge Your Innovation With Domain-Expert AI Agents!

Application of elemin in the preparation of medicines for treating lysosomal storage diseases

A technology of lysosomal storage disease and elemin, applied in the field of biomedicine, can solve the problems of easily causing other diseases, small benefits, and not being able to be used as a universal therapy for LSD

Active Publication Date: 2022-06-21
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gene therapy is limited by the efficiency of viral transfection and expression, and the DNA fragment inserted into the chromosome by the virus may cause mutations of other genes, chromosome instability and other problems, which may easily cause other diseases and increase the risk of cancer
Protein replacement therapy is generally only suitable for LSD caused by enzyme mutations in lysosomes, and due to the existence of the blood-brain barrier, the effect on brain cells is extremely poor
And protein replacement therapy requires regular injections of synthetic proteins, which is expensive
[0012]In addition to the shortcomings mentioned above, there is another limitation in the current treatment methods for LSD, that is, they are all for a single or the same type of pathogenesis of LSD , and cannot be used as a general treatment for most LSD
However, the incidence of a single LSD is extremely low, which leads to extremely low efficiency and minimal benefit for further optimization of the above treatment methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of elemin in the preparation of medicines for treating lysosomal storage diseases
  • Application of elemin in the preparation of medicines for treating lysosomal storage diseases
  • Application of elemin in the preparation of medicines for treating lysosomal storage diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Phenotypic identification of three lysosomal storage disease model cell lines used in the experiment

[0031] In order to screen small molecule libraries, three gene knockout model cell lines for lysosomal storage diseases were constructed in HeLa cells by CRISPR-Cas9 system, namely GLAKO (GLA knockout) and HEXAKO (HEXA knockout). ), and NPC1KO (NPC1 knockout). The DNA sequences used for transcribing into the corresponding gRNA during gene knockout are: GLA: GCTCCCCAAAGAGATTCAGA; HEXA: TTTCCCCGCTTTCCTCACCG; NPC1: CTGGACACAGTAGCAGCAGG. Among them, the knockout of GLA resulted in the loss of 7 bp bases in the 234 bp of the exon of the gene on both chromosomes, resulting in a frameshift, and the complete loss of GLA protein expression was confirmed by WB; the knockout of HEXA resulted in two chromosomes. The 539 bp of the exon of the gene on the gene all had an extra base to cause a frameshift, and the complete loss of HEXA protein expression was confirmed by W...

Embodiment 2

[0034] Example 2: Small Molecule Library Screening

[0035] Through the screening of a small molecule library of natural extracts (TargetMol Natural Compound Library, L6000), from 850 natural small molecules, it was found that Elemicin (Elemicin) has a positive effect on the phenotype of lysosomal storage diseases at the cellular level. Small molecules with significantly improved effects.

[0036] The specific screening process is as follows:

[0037] Lysosomes were labeled by Lysotracker (Thermo Fisher, Cat. No. L7528) in WT and three lysosomal storage disease model cell lines, and cells were treated with 10 μmolar concentration of small molecules for 48 hours and detected by flow cytometry The intracellular lysotracker fluorescence was used to calculate the total volume of intracellular lysosomes. Among them, the drugs that caused the total volume of lysosomes to decrease by more than 20% in all three cell lines and did not cause obvious cell damage to WT cells entered the...

Embodiment 3

[0038] Example 3: Elemisin significantly inhibits the phenotype of lysosomal storage disease cell lines

[0039] In Hela cells of WT, GLAKO, HEXAKO and NPC1KO, they were treated with 10 micromolar elemenin for 48 hours, and then lysotracker was used to label the intracellular lysosomes, and the intracellular lysosomes were captured by live cell imaging and analyzed by ImageJ. The amount of lysotracker fluorescence to quantify lysosome volume. The result is as Figure 5 Shown: Elemisin did not affect lysosomal volume in WT cells, whereas it inhibited the increase in lysosomal volume in the three LSD cell lines.

[0040] In Hela cells of WT, GLAKO, HEXAKO and NPC1KO, they were treated with 10 micromolar elemene for 48 hours, and then labeled with Philippine blue for intracellular cholesterol. The amount of Philippine blue fluorescence to quantify cholesterol storage. The result is as Image 6 Shown: Elemisin did not affect the amount of cholesterol in WT cells, whereas it in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of the small molecular compound elemin in the preparation of medicine for treating lysosomal storage diseases. In the present invention, by screening a small molecule library of natural extracts, the small molecule compound elemin is screened from 850 kinds of natural small molecules, which can effectively inhibit the phenotype of lysosomal storage diseases, for example, it can inhibit the volume of lysosomes increase, inhibit cholesterol storage, significantly restore inhibited lysosome tube formation, significantly restore tolerance to repeated starvation and reduce cell death rate, so as to achieve the purpose of reducing damage and inhibiting the development of the disease. Elemin has the prospect of being developed as a broad-spectrum drug for the treatment of lysosomal storage diseases.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to the application of elemenin in the preparation of medicines for treating lysosomal storage diseases. Background technique [0002] Lysosomal storage disease (Lysosomal Storage Disease, LSD) is a general term for a class of inherited diseases caused by lysosomal-related single gene mutations. About 50 types of lysosomal storage diseases have been identified in humans, each with an average incidence of less than 1 in 100,000, but the total incidence is about 1 / 10,000 to 1 / 5,000. [0003] The pathogenesis of LSD varies according to the mutated gene. The mutated genes can be enzymes responsible for degradation in lysosomes, proteins responsible for transporting substances on lysosomal membranes, proteins related to lysosomal membrane transport, and enzymes responsible for post-translational modification of lysosome-related proteins, etc. Although the pathogenesis is different, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/09A61P43/00A61P3/00
CPCA61K31/09A61P43/00A61P3/00
Inventor 李欣然冯新华向聪
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More