Application of elemin in the preparation of medicines for treating lysosomal storage diseases
A technology of lysosomal storage disease and elemin, applied in the field of biomedicine, can solve the problems of easily causing other diseases, small benefits, and not being able to be used as a universal therapy for LSD
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Phenotypic identification of three lysosomal storage disease model cell lines used in the experiment
[0031] In order to screen small molecule libraries, three gene knockout model cell lines for lysosomal storage diseases were constructed in HeLa cells by CRISPR-Cas9 system, namely GLAKO (GLA knockout) and HEXAKO (HEXA knockout). ), and NPC1KO (NPC1 knockout). The DNA sequences used for transcribing into the corresponding gRNA during gene knockout are: GLA: GCTCCCCAAAGAGATTCAGA; HEXA: TTTCCCCGCTTTCCTCACCG; NPC1: CTGGACACAGTAGCAGCAGG. Among them, the knockout of GLA resulted in the loss of 7 bp bases in the 234 bp of the exon of the gene on both chromosomes, resulting in a frameshift, and the complete loss of GLA protein expression was confirmed by WB; the knockout of HEXA resulted in two chromosomes. The 539 bp of the exon of the gene on the gene all had an extra base to cause a frameshift, and the complete loss of HEXA protein expression was confirmed by W...
Embodiment 2
[0034] Example 2: Small Molecule Library Screening
[0035] Through the screening of a small molecule library of natural extracts (TargetMol Natural Compound Library, L6000), from 850 natural small molecules, it was found that Elemicin (Elemicin) has a positive effect on the phenotype of lysosomal storage diseases at the cellular level. Small molecules with significantly improved effects.
[0036] The specific screening process is as follows:
[0037] Lysosomes were labeled by Lysotracker (Thermo Fisher, Cat. No. L7528) in WT and three lysosomal storage disease model cell lines, and cells were treated with 10 μmolar concentration of small molecules for 48 hours and detected by flow cytometry The intracellular lysotracker fluorescence was used to calculate the total volume of intracellular lysosomes. Among them, the drugs that caused the total volume of lysosomes to decrease by more than 20% in all three cell lines and did not cause obvious cell damage to WT cells entered the...
Embodiment 3
[0038] Example 3: Elemisin significantly inhibits the phenotype of lysosomal storage disease cell lines
[0039] In Hela cells of WT, GLAKO, HEXAKO and NPC1KO, they were treated with 10 micromolar elemenin for 48 hours, and then lysotracker was used to label the intracellular lysosomes, and the intracellular lysosomes were captured by live cell imaging and analyzed by ImageJ. The amount of lysotracker fluorescence to quantify lysosome volume. The result is as Figure 5 Shown: Elemisin did not affect lysosomal volume in WT cells, whereas it inhibited the increase in lysosomal volume in the three LSD cell lines.
[0040] In Hela cells of WT, GLAKO, HEXAKO and NPC1KO, they were treated with 10 micromolar elemene for 48 hours, and then labeled with Philippine blue for intracellular cholesterol. The amount of Philippine blue fluorescence to quantify cholesterol storage. The result is as Image 6 Shown: Elemisin did not affect the amount of cholesterol in WT cells, whereas it in...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



